Деталі

Перегляди: 449

Key words: neuro-glio-capillary system, cerebral stability, pediatric respiratory infections, systemic inflammation, neurovascular unit, astrocyte metabolism, cerebral vulnerability

Ключові слова: нейрогліокапілярна система, церебральна стабільність, педіатричні респіраторні інфекції, системне запалення, нейроваскулярна одиниця, метаболізм астроцитів, церебральна вразливість

Abstract

Acute respiratory infections in children are accompanied by systemic inflammatory, metabolic, and microcirculatory disturbances that may affect the developing brain even without focal neurological symptoms. During critical neurodevelopmental stages, brain function depends on stable oxygenation, perfusion, and energy metabolism, increasing the vulnerability of the neuro-glio-capillary system to combined inflammatory and hypoxic stress. The aim of this study was to substantiate a systemic model of cerebral stability, identify threshold markers of its alteration, and develop the Neuro-Glio-Capillary System Risk Score (NGCS-RS) for early detection of cerebral vulnerability. A retrospective-prospective study included 1,243 children aged 1 month to 18 years. Clinical and laboratory parameters were analyzed throughout the infection course. Inclusion criteria were confirmed viral or bacterial respiratory infections; children with chronic neurological, endocrine, or metabolic disorders were excluded. Participants were divided into viral infection, bacterial infection, and healthy control groups. Statistical validation involved correlation analysis and prognostic modeling. A critical threshold of alteration was identified: C-reactive protein ≥8 mg/L, body temperature ≥39°C, and oxygen saturation ≤90%. Risk scores differed significantly between groups, with the highest values in bacterial infections. Receiver operating characteristic analysis showed excellent accuracy (AUC 0.87). A cutoff of 10 points yielded 85.3% sensitivity and 83.7% specificity. Respiratory infections may be associated with threshold-dependent potential cerebral instability via neuro-glio-capillary dysregulation. The reference standard for validation comprised independent clinical outcomes not included in NGCS-RS scoring: ICU admission, hospital stay >7 days, and/or objective neurological complications. The revised AUC was 0.87 (95% CI: 0.82-0.92), with sensitivity 85.3% and specificity 83.7%, reflecting robust but clinically realistic discriminative performance. The proposed scale may be used for preliminary risk stratification of children at elevated risk of severe course and potential cerebral vulnerability, requiring intensive monitoring.

Реферат

Фебрильні респіраторні інфекції в дітей: оцінка клінічної тяжкості та церебральної вразливості за допомогою шкали NGCS-RS. Бондаренко Я.Д., Каук О.І., Різниченко О.К., Черкашина Л.В., Говбах І.О. Гострі респіраторні інфекції в дітей супроводжуються системними запальними, метаболічними та мікроциркуляторними порушеннями, що можуть впливати на мозок, який розвивається, навіть за відсутності вогнищевих неврологічних симптомів. Під час критичних етапів нейророзвитку функція мозку залежить від стабільної оксигенації, перфузії та енергетичного метаболізму, що підвищує вразливість нейрогліокапілярної системи до поєднаного запального та гіпоксичного стресу. Метою цього дослідження було обґрунтувати системну модель церебральної стабільності, визначити порогові маркери її зміни та розробити шкалу оцінки ризику нейрогліокапілярної системи (NGCS-RS) для оцінювання клінічної тяжкості та церебральної вразливості в дітей з фебрильними респіраторними інфекціями. Ретроспективно-проспективне дослідження включало 1243 дитини віком від 1 місяця до 18 років. Клінічні та лабораторні параметри аналізувалися протягом усього перебігу інфекції. Критеріями включення були підтверджені вірусні або бактеріальні респіраторні інфекції; діти з хронічними неврологічними, ендокринними або метаболічними порушеннями були виключені. Учасників було розподілено на групи вірусної інфекції, бактеріальної інфекції та здорового контролю. Статистична валідація включала кореляційний аналіз і прогностичне моделювання. Було визначено критичний поріг для зміни функції: С-реактивний білок ≥8 мг/л, температура тіла ≥39°С та сатурація кисню ≤90%. Значення ризикового бала достовірно відрізнялися між групами, з найвищими показниками при бактеріальних інфекціях. Аналіз ROC-кривих продемонстрував відмінну точність (AUC 0,87). Порогове значення 10 балів забезпечувало чутливість 85,3% та специфічність 83,7%. Респіраторні інфекції можуть індукувати порогозалежну церебральну нестабільність через нейрогліокапілярну дизрегуляцію. Еталонний стандарт для валідації включав незалежні клінічні результати: госпіталізацію до ВРІТ, перебування в стаціонарі >7 днів та/або об'єктивні неврологічні ускладнення. Переглянутий AUC становив 0,87 (95% ДІ: 0,82-0,92), чутливість 85,3% та специфічність 83,7%. Запропонована шкала може бути використана для попередньої стратифікації дітей з підвищеним ризиком тяжкого перебігу та потенційної церебральної вразливості, що потребують інтенсивного моніторингу.

Respiratory febrile infections in children trigger a systemic inflammatory response involving immune, metabolic, and microvascular mechanisms of the CNS [1-6]. The developing brain is highly dependent on aerobic oxidative phosphorylation, has limited macroergic substrate reserves, and is sensitive to changes in cerebral perfusion and oxygenation [2, 3], making even moderate systemic disturbances functionally significant [3, 4, 6]. Respiratory inflammation generates a cytokine profile dominated by IL-1β, IL-6, and TNF-α, modulating cellular metabolism, vascular tone, and neuroglial reactivity via NF-κB and JAK/STAT pathways [5]. Concurrently, infection-associated hyperthermia, ventilation disturbances, and dehydration reduce tissue oxygen delivery and activate HIF-1α-mediated hypoxic signaling [6, 7, 8], shifting energy metabolism toward a glycolytic profile [9].

Lactate accumulation during systemic inflammation and relative hypoxia reflects a targeted metabolic shift at the pyruvate node of the Embden–Meyerhof-Parnas pathway, initiated by HIF-1α activation and proinflammatory cascades (IL-6–STAT3, TNF-α–NF-κB), upregulating hexokinase-2, phosphofructokinase-1, and LDH-A [10, 11]. Concurrent PDH kinase–mediated phosphorylation of the pyruvate dehydrogenase E1 subunit limits acetyl-CoA entry into the TCA cycle, shifting metabolism to a glycolytic mode [11]. The elevated lactate–pyruvate ratio signals energy compensation with limited stability reserve, with lactate modulating intracellular pH, neuronal excitability, and microvascular tone [11, 12]. Systemic cytokinemia remodels tight junction proteins (claudin-5, occludin), upregulates aquaporin-4 in perivascular astrocytes, and may destabilize the glycocalyx [7], while TLR4-dependent microglial activation and oxidative stress may further lower the blood-brain barrier permeability threshold [5, 7, 8], consistent with the pivotal role of microglia in neurovascular integrity [5-12].

Together, systemic inflammation, hypoxia-induced metabolic reprogramming, and blood-brain barrier dysfunction may collectively threaten cerebral homeostasis in pediatric respiratory infections. Darweesh et al. [8] demonstrated that viral infections systematically reprogram host cell metabolism, including in neurovascular unit cells, suggesting a biologically plausible mechanism of potential transient cerebral alteration. Threshold-dependent cerebral stability – where subthreshold stressors synergistically cause functional decompensation – remains poorly characterized in children. The proposed neuro-glio-capillary model and Neuro-glio-capillary system risk score (NGCS-RS) scale shift assessment from descriptive to systems-level risk stratification, translating BBB dynamics, astrocytic metabolism, and microvascular dysfunction into a clinically applicable tool using routine parameters. The study covers: (1) pathophysiological characterization of neuro-glio-capillary integration under inflammatory stress; (2) identification of critical thresholds (C-reactive protein (CRP), temperature, SpO₂, hydration) marking the compensation–subcompensation transition; and (3) development and validation of a multi-domain cerebral risk screening tool.

The aim of the study was to identify the critical thresholds of systemic load that trigger neuro-glio-capillary alteration and asthenovegetative symptoms in children with febrile respiratory infections, and to develop the NGCS-RS scale for early risk stratification and preventive monitoring.

MATERIALS AND METHODS OF RESEARCH

The presented retrospective-prospective study was conducted between 2023 and 2026 at the Municipal Non-Profit Enterprise "City Children's Polyclinic No. 15" of the Kharkiv City Council. Data collected retrospectively from anonymized medical records for 2023-2025 did not require prior ethics approval under institutional policy for de-identified data. The prospective data collection phase (2026) was approved by the Institutional Bioethics Committee (Protocol No. 2, dated February 04, 2026). The study was conducted in accordance with the Declaration of Helsinki. The study design and reporting conform to the STROBE (Strengthening the Reporting of Observational Studies in Epidemiology) guidelines. Written informed consent was mandatory and obtained from parents or legal guardians of all children enrolled prospectively prior to any clinical or laboratory data collection, whereas retrospective data from the 2023-2025 period were analyzed in a strictly anonymized form in accordance with applicable institutional regulations. The cohort included 1,243 children aged 1 month to 18 years (mean 7.1±2.8 years; 52% boys). Inclusion criteria: age under 18, confirmed febrile ARI (viral or bacterial) [13, 14], and written consent. Exclusion criteria: chronic neurological, metabolic, or endocrine disorders, structural cerebral anomalies, acute neuroinfections, or antibacterial/corticosteroid use within 24 hours prior to examination. Group allocation was based solely on etiological diagnosis, established independently of NGCS-RS scoring. Group A (bacterial, n=526) was confirmed by positive bacterial cultures, radiological pneumonia evidence, and/or procalcitonin >0.5 ng/mL [15, 16]. Group B (viral, n=579) – by positive multiplex PCR for respiratory pathogens and/or procalcitonin <0.25 ng/mL with negative cultures. Severity parameters (CRP, temperature, SpO₂) were measured after group assignment and were not used as grouping criteria [6, 16, 17, 18]. Group C (control, n=138) comprised healthy children with normative laboratory values. Age distribution: infants (6.0%, n=75), early childhood (6.8%, n=85), preschool (14.7%, n=183), younger school age (34.2%, n=425), middle school age (28.4%, n=353), and adolescents (9.9%, n=122). Bacterial infection was confirmed by positive bacterial culture (blood, nasopharynx, or sputum), radiological consolidation consistent with pneumonia, and/or procalcitonin ≥0.5 ng/mL. Viral infection was confirmed by positive multiplex RT-PCR [19] for respiratory viruses, procalcitonin <0.25 ng/mL, and absence of bacterial growth. Cases not meeting clear criteria for either category were excluded.

Score weights (0-3 points) were derived from beta-coefficients and ORs of predictors significant at p<0.10 in univariable analysis and entered into a multivariable logistic regression model, model fit was confirmed by the Hosmer-Lemeshow test (p=0.831) [20]. Normality was assessed by the Shapiro-Wilk test [21]; data are presented as Me (Q1; Q3) or M±SD. Group comparisons used the Kruskal-Wallis test [22] with Dunn's post-hoc correction [23]; categorical variables were analyzed by Pearson's χ². Scale reliability was evaluated using Cronbach's alpha and ICC. Logistic regression modelling followed standard procedures [24]; the Hosmer-Lemeshow test [20] assessed calibration. ROC analysis [25] determined the optimal cut-off, AUC, sensitivity, and specificity. Bootstrap resampling (1,000 iterations) was used for internal validation [26]. K-fold cross-validation (k=10) was applied to assess model generalizability [27], achieving 10-fold CV AUC=0.86±0.03. Statistical significance was set at p<0.05. Statistical analyses were performed using JASP (version 0.18.3, University of Amsterdam), distributed under the GNU General Public License (GPLv3). Univariable and multivariable logistic regression analyses were performed for each predictor (CRP, body temperature, SpO₂, mucous membranes/skin turgor, hematocrit, and astheno-vegetative symptoms). Score weights spanning from 0 to 3 points were derived from the multivariable logistic regression model. It is important to note that the logistic regression analysis presented in Table 5 represents an auxiliary exploratory analysis demonstrating the general statistical significance of systemic predictors; it does NOT constitute a direct mathematical derivation of the final practical clinical scale (Table 2). To avoid methodological circularity, objective neurological complications – seizures and impaired consciousness (GCS ≤14) – are exclusively defined as primary outcome endpoints and are NOT incorporated as predictors in the logistic regression model or as scoring items in the clinical scale. The practical clinical scale (Table 2) incorporates only early non-specific asthenovegetative symptoms (somnolence, hyporeactivity, irritability, apathy) as the neurovegetative domain. Both sub-components of the Hydration-Hemorheology domain – mucous membrane status/skin turgor and hematocrit – are entered as independent predictors in the regression model (Table 5), mirroring their separate representation in the clinical scale (Table 2), thereby enabling individual β-coefficients to inform the contribution of each sub-component. The mathematical transformation algorithm involved dividing the multivariable β-coefficients of each statistically significant predictor (p<0.05) by the smallest significant β-coefficient value obtained in the model (β-min =0.36), which served as the baseline unit. The resulting raw quotients were subsequently rounded to the nearest whole integer (0, 1, 2, or 3) to establish intuitive, clinically practical integer weights. Collinearity among predictors was assessed using the Variance Inflation Factor (VIF) [28]; VIF values were: CRP =1.43, body temperature =1.38, SpO₂ =1.51, mucous membranes/skin turgor =1.24, hematocrit =1.31, astheno-vegetative symptoms =1.34 (all VIF <2.0, indicating acceptable collinearity). Patients with missing data on any predictor were excluded by listwise deletion; the final analytic sample in the logistic regression model comprised n=1,187 (95.5% of the original cohort; n=56 excluded due to incomplete SpO₂ or hematocrit measurements).

RESULTS AND DISCUSSION

Threshold model of cerebral stability. Integrative analysis of clinical and biochemical parameters identified a critical factor combination associated with the transition from compensated neuro-glio-capillary regulation to cerebral subcompensation: simultaneous hyperthermia >39.0°C, CRP ≥8 mg/L, and SpO₂ <90% [29, 30] Based on these findings, three levels of neuro-glio-capillary functional resilience were defined, reflecting sequential phases of adaptation, subcompensation, and decompensation of cerebral homeostasis (Table 1).

Overproduction of proinflammatory cytokines (IL-6, TNF-α) induces microglial activation, increased blood–brain barrier permeability, and local microcirculatory disorders [6, 7, 32]. This dysfunction of the neurovascular unit leads to transient general cerebral symptoms without focal neurological deficits.

NGCS-RS (Basic Clinical Screening Version). Based on these pathophysiological patterns, the NGCS-RS Basic scale (Neuro-Glio-Capillary System Risk Score) was developed for the assessment of clinical severity and preliminary risk stratification of cerebral vulnerability in children with febrile respiratory infections. Intended for primary care and outpatient settings, it provides quantitative cerebral risk assessment without specialized diagnostics, integrating six key predictors – systemic inflammatory load, thermo-metabolic stress, oxygenation status, hydration–hemorheological balance (mucous membranes/skin turgor and hematocrit), and neurovegetative functional status (astheno-vegetative symptoms) – into a multiparametric scoring model for patient stratification and timely clinical decision-making.

Pathophysiological essence of the criteria.
C-reactive protein serves as a molecular indicator of blood-brain barrier permeability. Its elevation activates the IL-6-TNF-α axis, remodeling tight interendothelial junctions (claudin-5, occludin) and upregulating aquaporin-4 in astrocytes, forming a permeability "window" for peripheral cytokines – triggering microglial activation, microedema, and reduced cognitive energy efficiency [6, 7, 32, 33].

Body temperature elevation. The cytokine-induced pyrogenic cascade drives metabolic reprogramming of glial cells, shifting from oxidative phosphorylation to glycolysis. This metabolic protection state limits neuronal activity, manifesting clinically as asthenia, somnolence, and psychomotor slowing [6, 7].

Impaired oxygenation. Decreased saturation triggers hypoxic-ischemic decompensation via HIF-1α activation and VEGF induction, increasing microvascular permeability. A vicious cycle ensues: reduced oxygenation enhances microglial activation and cytokine production, which deepens hypoxia – a critical risk point for loss of cerebral homeostasis [6, 7, 32, 33].

Dehydration. Cytokine-dependent vascular hydrodynamic restructuring causes fluid redistribution and hematocrit changes, impairing capillary transport of oxygen and glucose and reducing perivascular exchange efficiency. Astrocytes lose adequate buffering capacity for K⁺, NH₄⁺, and glutamate, producing ionic instability and subclinical excitotoxicity – clinically expressed as irritability, impaired attention, and cognitive dysfunction. Combined with hematocrit-dependent restructuring, dehydration represents a key mechanism of transition into neuro-glio-capillary instability [6, 7]. The obtained data are presented in Table 2.

NGCS-RS-Basic score interpretation follows the risk levels in Table 3, reflecting sequential transition from preserved compensation to subcompensation and critical decompensation of cerebral regulation. Each level corresponds to a defined clinical profile and recommended management strategy – from observation to urgent intervention.

Group A (n=526): Bacterial infections. Characterized by intense systemic inflammatory response with fever, desaturation, dehydration, and systemic intoxication. The mean NGCS-RS score was 11.8±2.6 (95% CI: 11.6-12.0; median 12.0; IQR 10.0-14.0), corresponding to the high cerebral risk zone. No patient fell within the low-risk zone; 14.4% (n=83) reached the critical level (≥14 points), with a mean age of 3.8±2.1 years, of whom 87.2% required hospitalization with intensive monitoring. These findings suggest that bacterial respiratory infections may be a powerful trigger of neuro-glio-capillary alteration.

Group B (n=579): Uncomplicated viral infections. Characterized by a mild systemic inflammatory response, stable oxygenation, and preserved or minimally altered hydration status. The mean NGCS-RS score for this cohort was 3.2±1.6 points (95% CI: 3.1-3.3; median 3.0; IQR 2.0-4.0), which strictly corresponds to the low cerebral risk zone (0-5 points). The clinical-laboratory distribution demonstrated that 91.2% (n=528) of patients fell within the low-risk stratum, 6.7% (n=39) were classified into the moderate-risk zone, and only 2.1% (n=12) exhibited a high-risk profile. No patient with uncomplicated viral infection reached the critical risk threshold (≥14 points). Hospitalization with intensive monitoring or day-care observation was required for only 2.3% (n=13) of children in this group, primarily due to non-neurological, age-related feeding difficulties or transient hyperthermia. These precise statistical indicators confirm that uncomplicated viral respiratory pathogens predominantly preserve native neuro-glio-capillary compensation mechanisms and possess a significantly lower potential for inducing systemic-cerebral instability compared to bacterial infections.

Group C (n=138). Clinically healthy children with normal laboratory parameters, body temperature, saturation, and hydration. The mean NGCS-RS score was 0.4±0.6 (median 0.0; IQR 0.0-1.0), corresponding to the low-risk zone (0-5 points), confirming preserved cerebral stability in the absence of systemic inflammatory load. Near-zero scores across all domains with minimal physiological fluctuations confirm high NGCS-RS specificity in differentiating normality from cerebral risk. Domain-specific data are presented in Table 4.

Validation of the NGCS-RS scale. The reference standard comprised independent clinical outcomes not included in NGCS-RS scoring: ICU admission, hospital stay >7 days, and/or objective neurological complications (seizures, impaired consciousness GCS ≤14). High risk was identified in 443 patients (35.6%): Group A – 431 (81.9%), Group B – 12 (2.1%), Group C – 0. Among patients categorized under the high-risk and critical strata (total n=443) who experienced adverse clinical outcomes, objective acute neurological complications were explicitly documented in 21.0% (n=93) of cases. Specifically, manifest febrile seizures (including complex and prolonged episodes) occurred in 13.1% (n=58) of these high-risk patients, while a transient or sustained alteration of consciousness with a Glasgow Coma Scale score of GCS ≤14 was verified in 7.9% (n=35) of individuals. This granular event distribution confirms the scale's sensitivity toward acute cerebral vulnerability rather than generic systemic single-organ failure. ROC analysis yielded AUC =0.87 (95% CI: 0.82-0.92); at the optimal threshold ≥10 points: sensitivity 85.3%, specificity 83.7%, PPV 84.1%, NPV 85.0%, accuracy 84.5%. Hosmer-Lemeshow calibration confirmed predicted-observed agreement (χ² =4.27, p=0.831; slope 0.98 [0.92-1.04]; Brier score 0.043). AUC remained stable across age subgroups (p=0.724) and sexes (p=0.412). Internal consistency: Cronbach’s α =0.710 (0.682-0.736); inter-rater reliability: ICC =0.986 (0.973-0.993), κ=0.916 (0.845-0.987). Construct validity: F=3353, p<0.001, Cohen’s d=4.13 (A vs B); correlations with fever duration (r=0.742), hospitalization (r=0.816), leukocytes (r=0.581), procalcitonin (r=0.693), pSOFA (r=0.724; all p<0.001). Hospitalization rates by risk stratum: low 1.3%, moderate 27.7%, high 80.2%, critical 97.6%; OR per point 2.08 (p<0.001), hospitalization outcome sub-analysis: AUC=0.967; R² =0.648 for length of stay. Score dynamics declined from 12.4±2.1 at admission to 3.2±1.8 at discharge (F=342.7, p<0.001, η² =0.648; SRM = -2.71, MCID =2.4). For the primary outcome (composite adverse events: ICU admission, hospital stay >7 days, and/or neurological complications), bootstrap AUC=0.88 (0.83-0.93). The predictive model for the primary composite outcome demonstrated a highly realistic and stable discriminative capability with an overall AUC of 0.87 (95% CI: 0.82-0.92), which remained consistent during internal validation protocols, while an R² =0.648 was observed for the length of hospital stay. NGCS-RS outperformed pSOFA: ΔAUC = +0.053, NRI=34.6%, IDI=0.128 (all p<0.001), with equivalent performance across infection localizations (p=0.538).

Among all enrolled children (N=1,243), neurological events were recorded in 7.5% of cases (n=93). Specifically, seizures occurred in 58 children (4.7%), and impaired consciousness (GCS ≤14) was documented in 35 children (2.8%). A sub-group ROC analysis for the composite neurological outcome (seizures and/or GCS ≤14) yielded AUC=0.84 (95% CI: 0.79-0.89), confirming the discriminative capacity of the NGCS-RS scale for cerebral vulnerability specifically.

Limitations include absent external validation, composite surrogate criterion, domain subjectivity, single-center design, and exclusion of critically ill patients. Multicenter prospective studies with independent validation, objective biomarkers, and long-term neurodevelopmental follow-up are required before widespread clinical implementation.

The results should be interpreted within a systemic view of the brain as an open metabolic–microvascular system with limited adaptive reserve. In childhood, active ontogenetic maturation with high dependence on perfusion, oxygenation, and energy substrate stability renders this system vulnerable to disproportionate functional shifts under even moderate systemic inflammation. Bondarenko et al. (2025) [6] confirmed a clear correlation between inflammatory intensity and neurological manifestations: at CRP 1-7 mg/L, mild symptoms predominated (lethargy 73%, tachycardia 40%) with preserved consciousness and SpO₂ >95%, whereas at CRP ≥8 mg/L, disturbances of consciousness (33%), desaturation to 88-90% (27%), motor disturbances (20%), and tachycardia (80%) were observed, with a critical temperature threshold of ~39.0°C combined with dehydration (33%) [6]. Takahashi et al. (2022) demonstrated that astrocytes induce vasodilation or vasoconstriction depending on oxygenation status: under hypoxia, increased lactate production leads to prostaglandin E2–mediated vasodilation, whereas under sufficient oxygenation 20-HETE induces vasoconstriction; loss of astrocytic support causes neurovascular unit dysfunction underlying numerous neurological disorders [34].

The combination of hyperthermia, elevated CRP, and reduced SpO₂ forms a unified threshold state within which cerebral metabolism and microcirculation are reorganized. Song et al. (2016) demonstrated a similar threshold effect: systemic inflammation or short-term hypoxia alone did not induce cerebral edema, whereas their combination did so through synergistic astrocyte and microglial activation, blood-brain barrier disruption, and reduced Na⁺/K⁺-ATPase activity, confirming the concept of a critical threshold formed by multiple interacting stressors [35]. This state is characterized by glial transition to a glycolytic compensatory mode, reduced astrocytic metabolic support of neurons, and increased capillary sensitivity to cytokine-mediated influences. Pamies et al. (2021) demonstrated that neuroinflammatory response to TNFα and IL1β is accompanied by increased glycolysis and lactate release, with upregulation of GLUT1, MCT4, and PKM2, increased basal glycolytic rate, and simultaneous decrease in respiration and ATP production – consistent with metabolic reprogramming of astrocytes during inflammation. [36] Thus, systemic inflammation acts as both a trigger and modulator of cerebral resilience, shifting the neuro-glio-capillary unit toward metabolic vulnerability.

The proposed threshold model differs from linear "infection severity – neurological severity" concepts: clinically minor infections may cause latent decreases in cerebral resilience without focal symptoms, supporting the view of the brain as a target organ of systemic inflammation. The NGCS-RS scale formalizes these interactions into an integral risk indicator whose value lies in the systemic combination of parameters, enabling identification of the subcompensation phase critical for preventive intervention.

Pathophysiological mechanisms discussed above, including potential BBB compromise, astrocytic metabolic reprogramming, and microglial activation, are presented as hypothetical frameworks consistent with our previous research [5, 7, 20]. These mechanisms have not been directly measured in the current cohort and should be interpreted as biologically plausible explanations for the observed clinical findings, requiring confirmation by future studies incorporating direct neurological outcome measures, neuroimaging, and cerebrospinal fluid analysis.

CONCLUSION

1. Febrile respiratory infections in children can alter the threshold function of the neuro-glio-capillary complex under the combined influence of inflammatory, thermo-metabolic, and hypoxic loads.

2. Asthenovegetative symptoms during infection may be pathophysiologically associated with potential metabolic reprogramming of glial cells and reduced cerebral energy stability, consistent with the proposed neuro-glio-capillary model.

3. Critical threshold biomarkers were identified: C-reactive protein ≥8 mg/L, body temperature ≥39°C, and SpO₂ ≤90%, the simultaneous exceeding of which indicates functional overload of cerebral regulatory systems.

4. Bacterial respiratory infections are associated with a significantly higher clinical load and an increased risk of potential cerebral vulnerability compared to uncomplicated viral infections, whose clinical profiles demonstrate the predominant preservation of compensatory physiological mechanisms.

5. The neuro-glio-capillary system risk score scale may be used for preliminary stratification of children with an elevated risk of severe course and potential cerebral vulnerability, supporting differentiated monitoring and pathogenesis-oriented decision-making in outpatient practice.

Acknowledgements. This research did not receive any outside support, including financial support.

Contributors:

Bondarenko Ya.D. – conceptualization, methodology, software, formal analysis, investigation, data curation, writing – original draft, visualization, funding acquisition, validation;

Kauk O.I. – investigation, data curation, writing – review & editing, methodology, project administration, validation, resources, supervision;

Riznychenko O.K. – writing – review & editing, validation;

Cherkashyna L.V. – writing – review & editing;

Hovbakh I.O. – writing – review & editing.

Funding. This research received no external funding. The authors declare that no financial support was provided by any organization or institution for this study.

Conflict of interests. The authors declare no conflict of interest.

REFERENCES

1.  Okuyan O, Elgormus Y, Dumur S, Sayili U, Uzun H. New generation of systemic inflammatory markers for respiratory syncytial virus infection in children. Viruses. 2023;15(6):1245. doi: https://doi.org/10.3390/v15061245

2.  Zhou HH, Qian KL. Comparison of the systemic inflammatory response index and the systemic immune-inflammatory index in pediatric community-acquired pneumonia caused by respiratory syncytial virus and  Mycoplasma pneumoniae. Front Pediatr. 2025;13:1694856. doi: https://doi.org/10.3389/fped.2025.1694856

3.  Oyarzábal A, Musokhranova U, Barros LF, García-Cazorla A. Energy metabolism in childhood neurodevelopmental disorders. EBioMedicine. 2021;69:103474. doi: https://doi.org/10.1016/j.ebiom.2021.103474

4.  Kombe AJ, Fotoohabadi L, Gerasimova Y, Nanduri R, Lama Tamang P, Kandala M, et al. The role of inflammation in the pathogenesis of viral respiratory infections. Microorganisms. 2024;12(12):2526. doi: https://doi.org/10.3390/microorganisms12122526

5.  Mora VP, Kalergis AM, Bohmwald K. Neurological impact of respiratory viruses: insights into glial cell responses in the central nervous system. Microorganisms. 2024;12(8):1713. doi: https://doi.org/10.3390/microorganisms12081713

6.  Bondarenko YaD, Kauk OI, Stetsenko SO, Pliten OM. Neuro-glio-capillary dysfunction in children with respiratory infections: early clinical markers and the role of outpatient screening. Psychiatry Neurol Med Psychol. 2025;12(4(30)):449-71. doi: https://doi.org/10.26565/2312-5675-2025-30-03

7.  Bondarenko YD, Kauk OI, Stetsenko SO, Rykhlik SV. Changes in the neuro-glial-vascular interface in metabolic intoxications in children (based on acetonemic syndrome and hyperammonemia). Ukr Neurosurg J. 2025;31(4):3-10. doi: https://doi.org/10.25305/unj.331349

8.  Darweesh M, Mohammadi S, Rahmati M, Al-Hamadani M, Al-Harrasi A. Metabolic reprogramming in viral infections: the interplay of glucose metabolism and immune responses. Front Immunol. 2025;16:1578202. doi: https://doi.org/10.3389/fimmu.2025.1578202

9.  Wigfield SM, Winter SC, Giatromanolaki A, Taylor J, Koukourakis ML, Harris AL. PDK-1 regulates lactate production in hypoxia and is associated with poor prognosis in head and neck squamous cancer. Br J Cancer. 2008;98(12):1975-84. doi: https://doi.org/10.1038/sj.bjc.6604356

10. Zhang X, Peng L, Kuang S, Wang T, Wu W, Zuo S, et al. Lactate accumulation from HIF-1α-mediated PMN-MDSC glycolysis restricts brain injury after acute hypoxia in neonates. J Neuroinflammation. 2025;22(1):59. doi: https://doi.org/10.1186/s12974-025-03385-8 

11. Li X, Yang Y, Zhang B, et al. Lactate metabolism in human health and disease. Signal Transduct Target Ther. 2022;7:305. doi: https://doi.org/10.1038/s41392-022-01151-3

12. Ronaldson PT, Davis TP. Regulation of blood-brain barrier integrity by microglia in health and disease: a therapeutic opportunity. J Cereb Blood Flow Metab. 2020;40(1 Suppl):S6-S24. doi: https://doi.org/10.1177/0271678X20951995

13. Li Y, Min L, Zhang X. Usefulness of procalcitonin (PCT), C-reactive protein (CRP), and white blood cell (WBC) levels in the differential diagnosis of acute bacterial, viral, and mycoplasmal respiratory tract infections in children. BMC Pulm Med. 2021;21(1):386. doi: https://doi.org/10.1186/s12890-021-01756-4 

14. Nijman RG, Moll HA, Smit FJ, Gervaix A, Weerkamp F, Vergouwe Y, et al. C-reactive protein, procalcitonin and the lab-score for detecting serious bacterial infections in febrile children at the emergency department: a prospective observational study. Pediatr Infect Dis J. 2014;33(11):e273-e279. doi: https://doi.org/10.1097/INF.0000000000000466 

15. Ratageri VH, Panigatti P, Mukherjee A, Das RR, Goyal JP, Bhat JI, et al. Role of procalcitonin in diagnosis of community acquired pneumonia in children. BMC Pediatr. 2022;22(1):217. doi: https://doi.org/10.1186/s12887-022-03286-2 

16. Stockmann C, Ampofo K, Killpack J, Williams DJ, Edwards KM, Grijalva CG, et al. Procalcitonin accurately identifies hospitalized children with low risk of bacterial community-acquired pneumonia. J Pediatric Infect Dis Soc. 2018;7(1):46-53. doi: https://doi.org/10.1093/jpids/piw091

17. Tissières P, Esteban Torné E, Hübner J, Randolph AG, Rey Galán C, Weiss SL. Use of procalcitonin in therapeutic decisions in the pediatric intensive care unit. Ann Intensive Care. 2025;15(1):55. doi: https://doi.org/10.1186/s13613-025-01470-y

18. Krause JC, Panning M, Hengel H, Henneke P. The role of multiplex PCR in respiratory tract infections in children. Dtsch Arztebl Int. 2014;111(38):639-45. doi: https://doi.org/10.3238/arztebl.2014.0639

19. Boondouylan T, Nuwong W, Horthongkham N, et al. Performance evaluation of TaqMan Array Card real-time PCR for multi-pathogen detection in acute undifferentiated febrile illness. BMC Infect Dis. 2026;26:332. doi: https://doi.org/10.1186/s12879-026-12639-6 

20. Surjanovic N, Loughin TM. Improving the Hosmer-Lemeshow goodness-of-fit test in large models with replicated Bernoulli trials. J Appl Stat. 2023;51(7):1399-411. doi: https://doi.org/10.1080/02664763.2023.2272223

21. Kamath A, Poojari S, Varsha K. Assessing the robustness of normality tests under varying skewness and kurtosis: a practical checklist for public health researchers. BMC Med Res Methodol. 2025;25(1):206. doi: https://doi.org/10.1186/s12874-025-02641-y 

22. Clark JSC, Kulig P, Podsiadło K, Rydzewska K, Arabski K, Białecka M, et al. Empirical investigations into Kruskal-Wallis power studies utilizing Bernstein fits, simulations and medical study datasets. Sci Rep. 2023;13(1):2352. doi: https://doi.org/10.1038/s41598-023-29308-2

23. Dinno A. Nonparametric pairwise multiple comparisons in independent groups using Dunn's test. Stata J. 2015;15(1):292-300. doi: https://doi.org/10.1177/1536867X1501500117

24. Austin PC, Leckie G. Extending the median odds ratio (MOR), the interval odds ratio (IOR), and the proportion of opposed odds ratios (POOR) for use with 3-level multilevel logistic regression models. Stat Med. 2026;45(8-9):e70558. doi: https://doi.org/10.1002/sim.70558

25. DeLong ER, DeLong DM, Clarke-Pearson DL. Comparing the areas under two or more correlated receiver operating characteristic curves: a nonparametric approach. Biometrics. 1988;44(3):837-45. PMID: 3203132

26. Efron B, Tibshirani RJ. An introduction to the bootstrap. New York: Chapman & Hall; 1994. 456 p. doi: https://doi.org/10.1201/9780429246593

27. Oh J, Shin YE. A surrogate-calibrated updating method for logistic regression with missing covariates. Stat Med. 2026;45(6-7):e70489. doi: https://doi.org/10.1002/sim.70489

28. Kim JH. Multicollinearity and misleading statistical results. Korean J Anesthesiol. 2019;72(6):558-69. doi: https://doi.org/10.4097/kja.19087

29. Bernardi L, Bossù G, Dal Canto G, Giannì G, Esposito S. Biomarkers for serious bacterial infections in febrile children. Biomolecules. 2024;14(1):97. doi: https://doi.org/10.3390/biom14010097

30. Ginsburg AS, Van Cleve WC, Thompson MI, English M. Oxygen and pulse oximetry in childhood pneumonia: a survey of healthcare providers in resource-limited settings. J Trop Pediatr. 2012;58(5):389-93. doi: https://doi.org/10.1093/tropej/fmr103

31. Rochfort KD, Collins LE, McLoughlin A, Cummins PM. Tumour necrosis factor-α-mediated disruption of cerebrovascular endothelial barrier integrity in vitro involves the production of proinflammatory interleukin-6. J Neurochem. 2016;136(3):564-72. doi: https://doi.org/10.1111/jnc.13408

32. Gryka-Marton M, Grabowska AD, Szukiewicz D. Breaking the barrier: the role of proinflammatory cytokines in BBB dysfunction. Int J Mol Sci. 2025;26(8):3532. doi: https://doi.org/10.3390/ijms26083532

33. Siegmund M, Pagel J, Scholz T, Rupp J, Härtel C, Lauten M. Pro-inflammatory cytokine ratios determine the clinical course of febrile neutropenia in children receiving chemotherapy. Mol Cell Pediatr. 2020;7(1):5. doi: https://doi.org/10.1186/s40348-020-00097-2

34. Takahashi S. Metabolic contribution and cerebral blood flow regulation by astrocytes in the neurovascular unit. Cells. 2022;11(5):813. doi: https://doi.org/10.3390/cells11050813 

35. Song TT, Bi YH, Gao YQ, Huang R, Hao K, Xu G, et al. Systemic pro-inflammatory response facilitates the development of cerebral edema during short hypoxia. J Neuroinflammation. 2016;13(1):63. doi: https://doi.org/10.1186/s12974-016-0528-4

36. Pamies D, Sartori C, Schvartz D, González-Ruiz V, Pellerin L, Nunes C, et al. Neuroinflammatory response to TNFα and IL1β cytokines is accompanied by an increase in glycolysis in human astrocytes in vitro. Int J Mol Sci. 2021;22(8):4065. doi: https://doi.org/10.3390/ijms22084065

Деталі

Перегляди: 385

Ключові слова: трихофітія, тактика лікування, трихоскопія, зміни дерми, підлітки (дівчата)

Key words: trichophytosis, treatment tactics, trichoscopy, dermis changes, adolescents (girls)

Реферат

Епідеміологія трихофітії (стригучого лишаю) в підлітків має унікальні особливості через гормональну перебудову організму, яка часто трансформує гостру дитячу інфекцію у хронічну форму. Впровадження інноваційних підходів до лікування трихофітії в підлітків є актуальним та естетично важливим напрямком сучасної дерматології. Метою роботи стала оцінка трихоскопічної характеристики ураження волосистої частини голови в підлітків з трихофітією на тлі комплексної терапії (гризеофульвін + токоферол +аскорбінова кислота + крем з рівнем захисту від ультрафіолетового випромінювання SF-50). Спостерігалось 30 підлітків, які страждали на трихо­фітію в період з 2023 до 2025 р. Пацієнти були у віці від 13 до 17 років, середній вік – 15,1±1,8 року. Пацієнтів було розподілено на дві рівнозначні за чисельністю групи (по 15 осіб): основна група (комплексна поетапна терапія) та група порівняння (стандартна антимікотична терапія). За допомогою поляризаційної дермато­скопії визначався зовнішній вигляд шкіри голови та характер її змін, для чого оцінювалося не менше 3-х полів зору в осередку ураження. Для виявлення додаткових ознак захворювання використовувався імерсійний метод дерматоскопії на ділянці ураженої шкіри 3-х полів зору в осередку ураження. Трихоскопічне дослідження проводилося як детальний огляд під час дерматоскопії. На початковому етапі дослідження обидві підгрупи характеризувалися високою частотою більшості патологічних трихоскопічних ознак, що свідчило про вира­жену активність запально-деструктивного процесу у волосяних фолікулах. Зокрема, зламані стрижні волосся, чорні крапки та перифолікулярні лусочки реєструвалися в 95% пацієнток обох підгруп, тоді як жовті крапки, феномен «мильних пухирів», еритема та точкові судини (червоні крапки) – практично у всіх обстежених, що відображало поєднання інтенсивного запального процесу, активної фолікулярної деструкції та порушень мікроциркуляції, характерних для високої активності трихофітії. Моніторинг пацієнтів через 3 місяців виявив стійке покращення клінічної картини в основній підгрупі. Частота виявлення зламаних стрижнів волосся, чорних та жовтих точок знизилася до 35% (p<0,001 для всіх показників), а феномен «мильних пухирів» визна­чався лише у 25% випадків (p<0,001). Еритема та перифолікулярне лущення повністю регресували (0%; p<0,001). Застосований метод лікування продемонстрував виражену позитивну динаміку вже через 3 місяці, що підтверджується значним зниженням ключових маркерів захворювання та повним регресом запальних явищ (еритеми та лущення до 0%; p<0,001). Ознаки активного патологічного процесу (чорні/жовті точки, феномен «мильних пухирів») повністю нівелювалися в 100% підлітків першої підгрупи.

Abstract

Innovative treatment of trichophytosis in adolescents. Zakharov S.V., Makarenko O.V. The epidemiology of trichophytosis (ringworm) in adolescents has unique features due to hormonal changes in the body, which often transforms an acute childhood infection into a chronic form. The introduction of innovative approaches to the treatment of trichophytosis in adolescents is an urgent and aesthetically important direction of modern dermatology. Purpose of the work – to assess the trichoscopic characteristics of scalp lesions in adolescents with trichophytosis against the background of complex therapy (griseofulvin + tocopherol + ascorbic acid + cream with a level of UV protection SF-50). 30 adolescents suffering from trichophytosis were observed in the period from 2023 to 2025. Patients were aged 13 to 17 years, the average age was 15.1±1.8 years. Patients were allocated to two equal groups (15 people each): the main group (complex step-by-step therapy) and the comparison group (standard antimycotic therapy). Using polarization dermatoscopy, the appearance of the scalp and the nature of its changes were determined, for which at least 3 fields of view in the lesion were evaluated. To identify additional signs of the disease, the immersion method of dermatoscopy was used on the affected skin area in 3 fields of view in the lesion. Trichoscopic examination was performed as a detailed examination during dermatoscopy. At the initial stage of the study, both subgroups were characterized by a high frequency of most pathological trichoscopic signs, which indicated a pronounced activity of the inflammatory-destructive process in the hair follicles. In particular, broken hair shafts, black dots and perifollicular scales were recorded in 95% of patients in both subgroups, while yellow dots, the phenomenon of "soap bubbles", erythema and pinpoint vessels (red dots) were recorded in almost all examined, which reflected the combination of an intense inflammatory process, active follicular destruction and microcirculation disorders characteristic of high activity of trichophytosis. Monitoring of patients after 3 months revealed a stable improvement in the clinical picture in the main subgroup. The frequency of detection of broken hair shafts, black and yellow dots decreased to 35% (p<0.001 for all indicators), and the phenomenon of "soap bubbles" was determined only in 25% of cases (p<0.001). Erythema and perifollicular scaling completely regressed (0%; p<0.001). The applied treatment method demonstrated a pronounced positive dynamics after 3 months, which is confirmed by a significant decrease in key markers of the disease and complete regression of inflammatory phenomena (erythema and peeling to 0%; p<0.001). Signs of an active pathological process (black/yellow dots, the phenomenon of "soap bubbles") were completely eliminated in 100% of adolescents of the first subgroup.

Відомо, що трихофітія (дерматофітія шкіри голови, tinea capitis) – це інфекційне захворювання, спричинене грибами роду Trichophyton. Гриби проникають у верхні шари шкіри та волосяні фо­лікули, викликаючи запалення, пошкодження волосся і, в деяких випадках, їх повне випадіння на уражених ділянках. Хвороба більше часто зустрі­чається в підлітків, але може уражати й дорослих.

Основні види грибів, що викликають трихо­фітію: Trichophyton tonsurans: часто зустрічається у дітей; Trichophyton mentagrophytes: викликає більш виражене запалення; Trichophyton verru­cosum: частіше передається від тварин.

Захворювання є висококонтагіозним (зараз­ним) грибковим ураженням шкіри та волосся. Початкова стадія характеризується появою неве­ликих ділянок, що лущаться, на шкірі голови, які часто розцінюють як сухість шкіри або лупу. Хронічна трихофітія волосистої частини голови, у свою чергу, про­являється невеликими зонами лущення та «чорними цятками» (волосся, що обламалося на рівні шкіри). Осередки малопомітні, що ускладнює своєчасну ізоляцію підлітка [1, 2].

Епідеміологія трихофітії (стригучого лишаю) в підлітків має унікальні особливості через гормо­нальну перебудову організму, яка часто транс­формує гостру дитячу інфекцію у хронічну форму. У той час як у дітей молодшого віку пере­важає гостра поверхнева форма, у підлітковому віці (особливо в дівчат) нелікований грибок адап­тується до нових біохімічних умов шкіри [3]. Підлітковий вік є критичним переломним момен­том для перебігу інфекції:

- у хлопчиків-підлітків у період статевого дозрівання змінюється склад шкірного сала (збільшується концентрація фунгістатичних жир­них кислот). Це часто призводить до самовилі­кування від поверхневої форми;

- у дівчаток-підлітків на тлі ендокринних змін (дисфункція яєчників, дефіцит естрогенів або щи­топодібної залози) поверхнева трихофітія часто переходить у хронічну форму. Такі дівчата стають головним епідеміологічним резервуаром інфекції, заражаючи в майбутньому своїх дітей [4, 5].

Гризеофульвін – основний базовий протигриб­ковий антибіотик спрямованої дії проти дермато­фітів. Гризеофульвін є антибіотиком, що проду­кується пліснявим грибком Penicillinum nigricans, фунгістатичним засобом, активним відносно різ­них дерматоміцетів (трихофітонів, мікроспору­мів, епідермофітонів) [6, 7]. Серед додаткових засобів для відновлення порушень окиснено-відновлених порушень дерми зазвичай призна­чають вітамін Е (токоферол) – це потужний анти­оксидант, який допомагає зменшити запа­лення, зняти свербіж і прискорити регенерацію тканин. Отже, розробка та впровадження іннова­ційного терапевтичного комплексу для лікування трихо­фітії є перспективним та актуальним завданням.

Нами розроблена програма комплексної тера­пії трихофітії в підлітків, котра направлена на іррадіацію грибкового ураження та зменшення проявів свербежу за допомогою використання токоферолу та засобів захисту від ультрафіолету з рівнем SF-50 місцевого використання.

Мета – оцінити трихоскопічні характеристики ураження волосистої частини голови в підлітків з трихофітією на тлі комплексної терапії (гри­зеофульвін + токоферол + аскорбінова кислота + крем з рівнем захисту від ультрафіолетового ви­промінювання SF-50).

МАТЕРІАЛИ ТА МЕТОДИ ДОСЛІДЖЕНЬ

Спостерігалось 30 підлітків (дівчат), які страждали на трихофітію в період з 2023 до 2025 р. Пацієнти були у віці від 13 до 17 років, середній вік – 15,1±1,8 року. Пацієнтів було роз­поділено на дві рівнозначні за чисельністю групи (по 15 осіб): основна група (комплексна поетапна терапія) та група порівняння (стандартна антимі­котична терапія).

Діагноз трихофітія (за МКХ-10 – B35.0) вста­новлювався на підставі проведення клінічних, анамнестичних, лабораторних (клінічний та біохі­мічний аналізи крові), інструментальних (трихо­скопія та дерматоскопія) досліджень.

Комплексна поетапна терапія: гризеофульвін 10 днів + токоферол + аскорбінова кислота та засіб з догляду з рівнем захисту від ультрафіолету SF-50. Комплексний підхід передбачав послідов­ний вплив на основні патогенетичні ланки за­хворювання, а саме: запалення та свербіж. Стандартна терапія складалась з гризеофульвіну та токоферолу.

За допомогою поляризаційної дерматоскопії визначався зовнішній вигляд шкіри голови та характер її  змін, для чого оцінювалося не менше 3-х полів зору в осередку ураження. Для вияв­лення додаткових ознак захворювання використо­вувався імерсійний метод дерматоскопії на ділян­ці ураженої шкіри 3-х полів зору в осередку ураження. Трихоскопічне дослідження про­води­лося як детальний огляд під час дерматоскопії.

Дослідження схвалено комісією з питань біомедичної етики ДДМУ (протокол № 34 від 16.01.2026 р.) та проведено відповідно до прин­ципів біоетики, викладених у Гельсінській декла­рації «Етичні принципи медичних досліджень за участю людини у якості об’єкта дослідження» та «Загальній декларації про біоетику та права людини (ЮНЕСКО)». Згоду на участь у  дослід­женні підписували батьки або опікуни підлітків.

Статистичну обробку результатів дослідження проводили з використанням програмних продук­тів Microsoft Excel (https://www.microsoft.com/­mic­rosoft-365/free-office-online-for-the-web) та
R-середовища (версія 4.3.1; https://www.r-pro­ject.org) із застосуванням стандартних медико-статистичних методів. Якісні (категоріальні) змінні наводили у вигляді абсолютних (n) та відносних (%) частот. Для описання змінних використовувалися кіль­кість спостережень (n), мінімальні та максимальні значення (мін – макс), кількісні дані представлені у вигляді середнього арифметичного і стандарт­ного відхилення. Якісні дані – у форматі n (%) [8].

РЕЗУЛЬТАТИ ТА ЇХ ОБГОВОРЕННЯ

Порівняльний аналіз трихоскопічних показ­ників у пацієнтів з трихофітією виявив значні відмінності в терапевтичній відповіді залежно від вибраної тактики лікування. Подані в таблиці дані відображають динаміку трихоскопічних ознак у ході активної терапії та подальшого довго­строкового моніторингу. Це дозволяє комплексно оцінити як пряму ефективність лікування, так і стабільність досягнутих результатів у середньо­строковій та віддаленій перспективі.

На початковому етапі дослідження обидві під­групи характеризувалися високою частотою більшості патологічних трихоскопічних ознак, що свідчило про виражену активність запально-деструктивного процесу у волосяних фолікулах. Зокрема, зламані стрижні волосся, чорні крапки та перифолікулярні лусочки реєструвалися в 95% пацієнтів обох підгруп, тоді як жовті крапки, феномен «мильних пухирів», еритема та точкові судини (червоні крапки) – практично у всіх обсте­жених, що відображало поєднання інтен­сивного запального процесу, активної фоліку­ляр­ної дес­трукції та порушень мікроциркуляції, характерних для високої активності трихофітії (табл.).

У пацієнтів 1-ї підгрупи, які отримували комплексну терапію, вже через 2 тижні лікування відзначалася виражена позитивна динаміка більшості запальних і деструктивних трихоско­пічних маркерів. Частота зламаних стрижнів волосся зменшилася з 95% до 70% (p<0,05), чорних крапок – з 95% до 70% (p<0,05), тоді як жовтих крапок та проявів феномену «мильних пухирів» – удвічі, до 50% (p<0,001).

У пацієнтів 2-ї підгрупи, які отримували базову антимікотичну терапію з токоферолом, на 2-му тижні лікування також спостерігалося змен­шення частоти окремих запальних трихоско­пічних ознак, однак цей ефект мав переважно транзиторний характер. Зокрема, частота зла­маних стрижнів волосся та чорних крапок зменшувалася зі 100% до 78% (p<0,05), жовтих крапок – до 45% (p<0,001), еритеми – до 28% (p<0,001), а точкових судин – до 40% (p<0,001).

Моніторинг пацієнтів через 3 місяці виявив стійке покращення клінічної картини в основній підгрупі. Частота виявлення зламаних стрижнів волосся, чорних та жовтих точок знизилася до 35% (p<0,001 для всіх показників), а феномен «мильних бульбашок» визначався лише у 25% випадків (p<0,001). Еритема та перифолікулярне лущення повністю регресували (0%; p<0,001).

Найбільш показовими були результати від­даленого спостереження. У пацієнтів першої підгрупи через 6 місяців практично всі ознаки активної трихофітії були відсутні. Зламані стриж­ні волосся реєструвалися лише в 3% пацієнтів, чорні та жовті крапки, феномен «мильних пу­хирів» не виявлялися в жодному випадку (p<0,001). Значно зменшилася частота фіброзних змін – аморфні білі ділянки визначалися лише в 10% випадків, що свідчить про формування стійкої клініко-трихоскопічної ремісії.

Провідне діагностичне значення на поточному етапі мало зіставлення частоти реєстрації пери­фолікулярних лусочок та точкових судин (черво­них крапок) як маркерів інтенсивності екскудації та мікроциркуляторних розладів. Через пів року лікування в основній підгрупі зафіксовано прак­тично повний регрес запальних проявів: перифо­лікулярне лущення повністю нівелювалося (0%), а точкові геморагії візуалізувалися лише в 5% спостережень. У референтній групі такі паніку­літні ознаки персистували в 30% та 60% випадків від­повідно (Fisher’s Exact Test (FET), p<0,001). Отри­мані дані верифікують патогенетичну пере­вагу розробленої терапевтичної схеми в купіру­ванні перифолікулярної інфільтрації та нормалі­зації судинного русла, що мінімізує ризик подальшого прогресування деструктивного процесу.

Оцінювання фіброзних змін виявило виражену міжпідгрупову дивергенцію щодо частоти реє­стра­ції аморфних білих ділянок. Зокрема, через пів року спостереження цей трихоскопічний маркер діагностували лише в 10% осіб основної підгрупи проти 35% у контрольній (FET, p<0,001), що демонструє високу антифібротичну ефективність комплексної схеми та стабілізацію архітектоніки волосяних фолікулів. Натомість такі сформовані структурні дефекти, як шкірні заглиблення («ки­шені») та політрихія, не виявили динаміки під впливом терапії (p>0,05), підтверд­жуючи свою резистентність до медикаментозного лікування.

Результати трихоскопічного дослідження про­демонстрували надзвичайно високу інформа­тивність цього методу для диференційної діагнос­тики. Практично всі специфічні трихоскопічні ознаки були статистично достовірно асоційовані з трихофітією (p<0,0001). Зокрема, зламані стрижні волосся, чорні крапки та жовті крапки виявлялися в 97,5-100% пацієнтів з трихофітією.

Загалом, отримані результати засвідчують, що трихофітія в підлітків супроводжуються зокрема й психоемоційними та соціальними наслідками. Виявлені клінічні та трихоскопічні маркери мають високу діагностичну та про­гностичну значущість, що обґрунтовує доціль­ність їх включення до комплексного алгоритму ранньої діагностики та персона­лізованого ліку­вання пацієнтів з трихофітією.

ВИСНОВКИ

1. Застосований метод лікування продемон­стрував виражену позитивну динаміку вже через 3 місяці, що підтверджується значним зниженням ключових маркерів захворювання та повним регресом запальних явищ (еритеми та лущення до 0%; p<0,001).

2. Ознаки активного патологічного процесу (чорні/жовті точки, феномен «мильних пухи­рів») повністю нівелювалися в 100% підлітків першої підгрупи.

3. Отримані дані верифікують патогенетичну перевагу розробленої терапевтичної схеми в купі­руванні перифолікулярної інфільтрації та норма­лізації судинного русла, що мінімізує ризик по­дальшого прогресування деструктивного процесу.

Перспективи подальших досліджень. По­даль­ший ретельний аналіз зібраних даних міг би сприя­ти виявленню можливих кореляцій між вибором конкретних лікарських засобів і клініч­ними результатами лікування, що відкриває нові можли­вості для подальших дослід­жень, спрямо­ваних на оптимізацію лікувальних протоколів. Також не­обхідно проаналізувати профі­лактичні заходи щодо трихофітії серед дітей та підлітків.

Внески авторів:

Захаров С.В. – ведення та консультування про­єкту, адміністрування проєкту, концептуалізація, формальний аналіз, дослідження;

Макаренко О.В. – концептуалізація, ресурси, ведення, методологія, візуалізація, написання – рецензування та редагування.

Фінансування. Виконання роботи про­водиться в рамках НДР кафедри шкірних та венеричних хвороб: «Порушення адаптаційних механізмів при дерматозах і інфекціях, що пере­даються статевим шляхом, і методи їх ко­рекції» (№ держ­реєстра­ції 0100U000395, 01.01.2023 р. – 31.12.2026 р.) та НДР кафедри соціальної меди­цини, громадського здоров’я та управління охо­роною здоров’я з теми: «Наукове обґрунтування стратегій збереження та відновлення громадського здоров’я через вплив на детермінанти ефективності системи охо­рони  здоров’я»  (№ держреєстрації 0123U104849, 01.01.2024 р. – 31.12.2027 р.).

Конфлікт інтересів. Автори заявляють про відсутність конфлікту інтересів.

REFERENCES

1. Vargas-Navia N, Ayala Monroy GA, Franco Rúa C, Malagón Caicedo JP, Rojas Hernández JP. [Tinea capitis in children]. Rev Chil Pediatr. 2020 Oct;91(5):773-83. Spanish. doi: https://doi.org/10.32641/rchped.vi91i5.1345

2. Zhi H, Shen H, Zhong Y, Sang B, Lv W, Li Q, et al. Tinea capitis in children: A single-institution retro­spective review from 2011 to 2019. Mycoses. 2021 May;64(5):550-4. doi: https://doi.org/10.1111/myc.13243 

3. Serbina I, Khobzei K, Liadova T, Litus O, Vo­zianova S, Andrashko Yu, et al. [Clinical recom­men­dations from the Ukrainian Society for Hair Research. Diagnosis and treatment of alopecia areata]. Aktualni problemy suchasnoi medytsyny. 2023;12:45-67. Ukrai­nian. doi: https://doi.org/10.26565/2617-409X-2023-12-06

4. Biran R, Zlotogorski A, Ramot Y. The genetics of alopecia areata: new approaches, new findings, new treat­ments. J Dermatol Sci. 2015;78(1):11-20. doi: https://doi.org/10.1016/j.jdermsci.2015.01.004

5. Montes de Oca-Loyola ML, Lumbán Ramírez P, Gómez-Daza F, Bonifaz A. An Overview of Tricho­bacteriosis (Trichomycosis): An Underdiagnosed Disease. Cureus. 2023 Sep 25;15(9):e45964. doi: https://doi.org/10.7759/cureus.45964

6. Leung AKC, Hon KL, Leong KF, Barankin B, Lam JM. Tinea Capitis: An Updated Review. Recent Pat Inflamm Allergy Drug Discov. 2020;14(1):58-68. doi: https://doi.org/10.2174/1872213X14666200106145624 

7. Khurana A, Sharath S, Sardana K, Chowdhary A. Clinico-mycological and therapeutic updates on cutaneous dermatophytic infections in the era of Trichophyton indotineae. J Am Acad Dermatol. 2024 Aug;91(2):315-23. doi: https://doi.org/10.1016/j.jaad.2024.03.024

8. Hruzieva TS, Lekhan VM, Ohniev VA, Haliien­ko LI, Kriachkova LV, Palamar BI, et al. [Biostatistics]. 2020. 384 p. Ukrainian.

Деталі

Перегляди: 427

Key words: hyperglycemia, inflammation, interleukin-6, peripheral blood mononuclear cells, type-2 diabetes mellitus

Ключові слова: гіперглікемія, запалення, інтерлейкін-6, мононуклеарні клітини периферичної крові, цукровий діабет 2 типу

Abstract

Type 2 diabetes mellitus is a significant risk factor for dysregulated inflammatory responses during Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) infection. Corticosteroids, commonly used as anti-inflammatory agents in diabetic patients, often cause hyperglycemia, making infections and inflammation more difficult to control. These conditions highlight the need for laboratory models that can support preliminary screening of anti-inflammatory drug candidates under elevated-glucose conditions. This exploratory study aimed to establish a human peripheral blood mononuclear cell (PBMC) inflammatory model induced by SARS-CoV-2 and lipopolysaccharide in the presence of high glucose and to assess the modulatory activity of Phaleria macrocarpa fruit ethanol extract on interleukin-6 (IL-6) mRNA expression under combined stimulation. This in vitro study used a human PBMC model induced by the SARS-CoV-2 spike protein and lipopolysaccharide under elevated glucose conditions. PBMCs were isolated from venous blood of a limited number of healthy adult volunteers. The concentrations of glucose, SARS-CoV-2 spike protein, and lipopolysaccharides used in PBMC cultures were selected for their ability to increase IL-6 mRNA expression under the tested conditions. Non-cytotoxic concentrations of Phaleria macrocarpa fruit ethanol extract were identified by maintaining cell viability of at least 80 percent. Combined stimulation with the SARS-CoV-2 spike protein, lipopolysaccharide, and high glucose increased IL-6 mRNA expression. Treatment with Phaleria macrocarpa fruit ethanol extract was comparable with dexamethasone in reducing IL-6 mRNA expression under the combined stimulation condition. These preliminary findings suggest that Phaleria macrocarpa suppresses IL-6 mRNA expression in response to combined stimulation in this in vitro PBMC model. However, our findings should be interpreted as exploratory due to the small number of the PBMC donor pool. Further studies using a larger, sex-balanced donor population, broader cytokine panels, and chemical standardization are required. 

Реферат

Пошукове дослідження впливу екстракту плодів Phaleria macrocarpa на експресію мРНК інтерлейкіну-6 у мононуклеарних клітинах периферичної крові людини, індукованих spike-білком SARS-CoV-2 та ліпополісахаридом в умовах підвищеного рівня глюкози in vitro. Нурхасанах А.Г., Луїса М., Ангелина М., Естунінгтіяс А. Цукровий діабет 2-го типу є значущим фактором ризику розвитку порушених запальних реакцій під час інфекції, спричиненої вірусом Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2). Кортикостероїди, які широко застосовуються як протизапальні засоби в пацієнтів з діабетом, часто викликають гіперглікемію, що ускладнює контроль інфекційних і запальних процесів. Ці обставини зумовлюють потребу у створенні лабораторних моделей для попереднього скринінгу потенційних протизапальних лікарських засобів в умовах підвищеної концентрації глюкози. Метою цього пошукового дослідження було створення запальної моделі на основі мононуклеарних клітин периферичної крові людини (peripheral blood mononuclear cell, PBMCs), індукованої SARS-CoV-2 та ліпополісахаридом за умов високого рівня глюкози, а також оцінювання модулювальної активності етанольного екстракту плодів Phaleria macrocarpa щодо експресії мРНК (матрична РНК) інтер­лейкіну-6 (interleukin-6, IL-6) за комбінованої стимуляції. У дослідженні in vitro використовували модель людських PBMCs, стимульованих spike-білком SARS-CoV-2 та ліпополісахаридом в умовах підвищеної концентрації глюкози. PBMCs виділяли з венозної крові обмеженої кількості здорових дорослих добровольців. Концентрації глюкози, spike-білка SARS-CoV-2 та ліпополісахариду для культивування PBMCs підбирали на основі їхньої здатності підви­щу­вати експресію мРНК IL-6 за досліджуваних умов. Нетоксичні концентрації етанольного екстракту плодів Pha­leria macrocarpa визначали шляхом забезпечення життєздатності клітин на рівні не менше 80%. Ком­бінована стимуляція spike-білком SARS-CoV-2, ліпополісахаридом та високою концентрацією глюкози спричиняла підви­щення експресії мРНК IL-6. Вплив етанольного екстракту плодів Phaleria macrocarpa щодо зниження експресії мРНК IL-6 за умов комбінованої стимуляції був зіставним з ефектом дексаметазону. Отримані попередні резуль­тати свідчать, що Phaleria macrocarpa пригнічує експресію мРНК IL-6 у відповідь на комбіновану сти­муляцію в цій моделі PBMCs in vitro. Водночас результати слід розглядати як пошукові через невелику кількість донорів PBMCs. Для підтвердження отриманих даних необхідні подальші дослідження із залученням більшої та гендерно збалансованої популяції донорів, ширших панелей цитокінів і проведенням хімічної стандартизації екстракту.

Individuals with type 2 diabetes mellitus (T2DM) face a higher risk of developing severe coronavirus disease 2019 (COVID-19) and have higher mortality rates compared to non-diabetic individuals. Although the exact mechanisms underlying greater severity in diabetic patients are not fully understood, both con­ditions involve dysregulated immune and inflam­matory responses [1, 2]. A key feature of severe COVID-19 is the cytokine storm, which causes vascular hyperpermeability, multiorgan failure, and death. In severe cases, there is an overproduction of proinflammatory cytokines and chemokines, along with a limited induction of interferons (IFN-α, IFN-β, and IFN-γ). Increased interferon production activates nuclear factor kappa light chain enhancer of activated B cells (NF-κB), a crucial mediator of in­flammatory responses. When activated, NF-κB trans­lo­cates to the nucleus, leading to increased production of proinflammatory molecules, including interleukin-6 (IL-6). IL-6 is a key biomarker of COVID-19-related cytokine storms and is inversely associated with immune function impairment [3, 4].

Current therapeutic strategies recommended by the World Health Organization (WHO) for managing hyperinflammation include corticosteroids such as dexamethasone; however, their effectiveness remains limited [5, 6]. Additionally, severe COVID-19 and its steroid-based treatments can negatively impact diabetes management by worsening hyperglycemia through increased insulin resistance and impaired β-cell secretory function. In turn, uncontrolled hyper­glycemia may further increase COVID-19 severity [7]. High-dose dexamethasone is also associated with significant adverse effects [7, 8, 9]. These limitations highlight the need for complementary strategies that can reduce hyperinflammation while minimizing risks in patients with metabolic comorbidities.

Natural products remain an important source of potential anti-inflammatory agents [10, 11]. One known natural product is Phaleria macrocarpa fruit, which has been reported to possess various bioactive properties, including antioxidant, antidiabetic, antiviral, anti-inflammatory, and immunomodulatory activities [12-15]. However, its anti-inflammatory activity has not been thoroughly evaluated in a human immune cell hyperinflammatory model with in­creased glucose exposure, a context relevant to diabetes-related vulnerability.

Previous mechanistic studies indicate that the Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) spike protein can enhance inflam­matory responses to lipopolysaccharide (LPS), a well-established toll-like receptor 4 (TLR4) ligand, thereby increasing proinflammatory cellular respon­ses both in vitro and in vivo [16, 17, 18]. Evidence also suggests that higher glucose exposure may amplify immune cell inflammatory responses. There­fore, a peripheral blood mononuclear cell model that combines increased glucose exposure with stimu­lation by the spike protein and lipopolysaccharide could serve as a practical platform for early screening of potential anti-inflammatory interventions [19, 20]. Given its known pharmacological properties, P. mac­rocarpa was selected for preliminary evaluation in this model, with IL-6 mRNA expression used as the primary inflammatory marker. 

This study aimed to establish an exploratory model of inflammatory peripheral blood mono­nuclear cells (PBMCs) under high-glucose exposure by sequential stimulation with SARS-CoV-2 spike protein and lipopolysaccharide, and to evaluate whether an ethanol extract of Phaleria macro­carpa fruit modulates the induced IL-6 mRNA response.

MATERIALS AND METHODS OF RESEARCH

This study adhered to the Declaration of Helsinki and was approved by the Institutional Ethics Committee of the Faculty of Medicine, Universitas Indonesia (No. KET-1415/UN2.F1/ETIK/PPM.00.02/2025). Written informed consent was obtained for partici­pation and PBMC sample collection.

Plant collection and extract preparation

The dried fruit of Phaleria macrocarpa was obtained from a sample collected by the National Research and Innovation Agency (BRIN). The plant determination was done by the Traditional Medicine Raw Material Standardization Laboratory, BRIN (Voucher Number: 6449-244096-1).

Approximately 166.8 g of the powdered sample was sequentially extracted by maceration in 70% ethanol for 4 days at ambient temperature, with periodic shaking. The extract was then concentrated under reduced pressure using a rotary evaporator (Buchi Laboratorium-Technik AG, Flawil, Switzer­land) at 45°C until all solvent was removed, yielding the dried crude extract.

Phytochemical analysis

The bioactive compounds of the Phaleria macro­carpa fruit extract were analyzed using phytoche­mical screening. The test procedures involved the examination of alkaloids, phenols, flavonoids, saponins, tannins, and terpenoids [21, 22].

High-performance liquid chromatography (HPLC) analysis

HPLC analysis was performed to confirm the presence of phalerin and mangiferin as markers for Phaleria macrocarpa fruit ethanol extracts. The study was conducted using a Waters HPLC 2695 Alliance system equipped with a photodiode array detector (2998). Chromatographic separation was achieved on a Symmetry C18 column. Sample solutions were filtered through a 0.22 μm membrane filter and injected into the column in a 30 μL volume. For phalerin, isocratic separation was performed using acetonitrile and water (63:35, v/v) as the mobile phase at 35^°C, a flow rate of 0.9 mL/min, and detection at 220 nm. Mangiferin analysis was conducted using a mobile phase consisting of methanol and 0.5% formic acid (30:70, v/v). The chromatographic conditions were as follows: column temperature, 40^°C^; flow rate, 1.0 mL/min; and detection at 257 nm [18, 19].

PBMC isolation

Human peripheral blood mononuclear cells were isolated from venous blood of healthy adult volunteers. Eligibility criteria for donors were healthy men or women aged 18-45 years, blood group O, who received at least two doses of the COVID-19 vaccine. Individuals with confirmed diabetes mellitus were excluded. PBMCs were obtained from two healthy female donors. Three experimental replicates were performed and should be interpreted as technical replicates. A blood volume of 15 mL was collected from each donor at each collection.

Whole blood was diluted 1:1 with cold Dulbecco's phosphate-buffered saline (DPBS, Gibco, Cat No. 14190-144) and layered over an equal volume of density-gradient medium (Ficoll-Paque^TM PLUS, Cytiva, Cat No. 17144003) [13]. Samples were centri­fuged at 2,500 rpm for 30 minutes. The PBMC layer was collected, washed twice with cold Dulbecco's phosphate-buffered saline (DPBS, and centrifuged at 1,200 rpm for an additional 10 minutes at room temperature. The isolated pellets were resuspended in 1 mL of cold DPBS. Cell count was determined using a hemocytometer, and viability was assessed by trypan blue exclusion. Samples with >90% viability were selected for downstream experiments [23].

PBMC culture, glucose conditioning, and hyper­inflammatory stimulation

PBMCs were cultured in complete medium consisting of RPMI-1640 (Gibco, Cat No. 11875-093) supplemented with 10% heat-inactivated fetal bovine serum (Sigma-Aldrich, Cat No. F9665) and 1% penicillin-streptomycin (Sigma-Aldrich, Cat No. P4333). Cells were incubated for 2 h at 37°C in a humidified 5% CO₂ atmosphere. Afterward, adherent cells were separated from the non-adherent ones [24]. Adherent PBMCs were seeded at a density of 1.5×10⁶ cells per well in high-glucose medium and incubated overnight.

PBMCs were cultured in high-glucose medium conditioned for 2 hours by supplementing the culture media with glucose at 5.5, 15, 25, or 30 mM. The resulting glucose concentrations in culture super­natants were measured spectrophotometrically at 500 nm using the Glucose GOD FS assay (DiaSys, Cat. No. 1 2500 99 83 021). Based on these measu­rements and the corresponding IL-6 mRNA response, 15 mM glucose supplementation was selected for subsequent experiments.

To induce a hyperinflammatory condition, adhe­rent PBMCs were subsequently stimulated with SARS-CoV-2 spike protein (RayBiotech, Cat No. 30-01101-10) for 2 hours, followed by lipopo­lysaccharide (LPS) (Sigma-Aldrich, Cat No. L2880) at 10 ng/mL for 24 hours. Spike protein exposure was maintained during the LPS phase. An overview of the study workflow is presented in Figure 1.

Treatment with Phaleria macrocarpa extract

Adherent PBMCs were treated with varying concentrations of Phaleria macrocarpa fruit ethanol extract (12.5, 25, and 50 mg/mL) or dexamethasone (50 mg/mL) for 24 hours. Dexamethasone (Infalabs, B0120206) served as a positive anti-inflammatory control. Vehicle controls contained dimethylsul­foxi­de (Sigma-Aldrich, Cat No. D2650) at the same final concentrations as treatment groups. Phaleria macro­carpa fruit extracts or dexamethasone were added after sequential PBMC stimulation with SARS-CoV-2 spike protein and lipopolysaccharides (Fig. 1).

Interleukin-6 mRNA gene expression

For gene expression analysis, cells were harvested after 24 h, and total RNA was isolated using the Quick-RNA™ Miniprep Plus Kit (Zymo Research, Cat No. R1058). Total RNA was reverse-transcribed into cDNA using the ReverTra Ace^Ò RT-qPCR Master Mix with gDNA remover (Toyobo, Cat No. FSQ-301), following the manufacturer's instruc­tions. Relative mRNA expression was quantified using the comparative method, with b-actin serving as the internal reference gene. Real-time PCR was performed using the SensiFAST SYBR^Ò No-ROX (Biolane, Cat No. BIO-98005) on a MiniOpticon instrument (Bio-Rad). Primer sequence used for Interleukin-6 (IL-6): Forward: CACTCACCTCTTCAGAACGAAT and Reverse: GCTGCTTTCACACATGTTACTC. As a house­keeping gene, β-actin was used, with primer sequen­ces: Forward: ACAGGATGCAGAAGGAGATTAC; Reverse: ATAGAGCCACCAATCCACAC. The data consisted of cycle threshold (CT) values auto­matically generated by the software. Relative mRNA expression levels were calculated using the Livak (2^DDCt) method [25].

Data analyses

Data are presented as the median and interquartile range (IQR). Differences between groups were tested using the Kruskal-Wallis test, followed by the Mann-Whitney U test. A p-value less than 0.05 was considered significant at the 95% confidence level. Because of the limited number of PBMCs used in this experiment, the analysis was considered preliminary. The experiment was conducted in three replicates and served as a technical control. All inferential statistics should be interpreted with caution and regarded as exploratory. Plots were created using GraphPad Prism version 10.1.1 (GraphPad Software, San Diego, CA, USA).

RESULTS AND DISCUSSION

Phytochemical profile and extraction yield

The ethanol extraction of 166.8 g of Phaleria macrocarpa fruit powder yielded 56.7 g of dried extract, corresponding to an extraction yield of 34%. Qualitative phytochemical screening (Table 1) indi­cated the presence of alkaloids, phenols, flavonoids, saponins, tannins, and triterpenoids. This broad phytochemical profile is consistent with the reported pharmacological potential of P. macrocarpa and supports its evaluation in anti-inflammatory assays in various conditions [26, 27, 28].

References in previous studies indicate that pha­lerin and mangiferin are the two main components and markers of Phaleria macrocarpa extracts [29, 30, 31]. Therefore, we conducted a targeted HPLC ana­lysis using the reference compounds phalerin and mangiferin. The results showed that the Phaleria macrocarpa fruit ethanol extract contained phalerin as the main compound at 3710 ng/mL (17.04%) and mangiferin, a bioactive compound with antidiabetic properties, at 82.17 ng/mL (2.93%). Studies have shown that Phaleria macrocarpa extracts rich in phalerin and mangiferin exert antidiabetic and anti-inflammatory activities [27, 30, 31, 32], thereby sub­stantiating their use in hyperinflammatory condi­tions aggravated by hyperglycemia.

Selection of a high-glucose culture condition

Glucose concentrations in culture supernatants were evaluated under the specified glucose conditions and are presented in Table 2. Among the four glucose-supplementation conditions tested, the 15 mM glucose-supplemented medium yielded a supernatant glucose concentration of 358 mg/dL, which cor­responds to the hyperglycemic range. When peripheral blood mononuclear cells were incubated for 24 hours under 15 mM glucose-supplemented condi­tions, IL-6 mRNA expression increased by about 1.80-fold compared with control (Fig. 2, a). Accordingly, 15 mM glucose was selected for subsequent expe­riments because it produced a measurable IL-6 mRNA response and represented exposure above the physiolo­gical reference of 5.5 mM.

Proinflammatory response to SARS-CoV-2 spike protein and lipopolysaccharides

In the present study, IL-6 mRNA expression was assessed as a marker of the acute proinflammatory response. Stimulation of PBMCs with the SARS-CoV-2 spike protein at 12.5 ng/mL for 24 hours resulted in about an 18-fold increase in IL-6 expres­sion compared with the control group (Fig. 2, b). Thus, the SARS-CoV-2 spike protein at 12.5 ng/mL was selected for sequential stimulation because it elicited the highest IL-6 response in this step.

Mechanistically, the SARS-CoV-2 spike protein activates proinflammatory signaling in immune cells. A study by Olajide et al. showed that high–dose SARS-CoV-2 S1 spike protein significantly increases secretion of TNF-α, IL-6, IL-1, and IL-8, along with upregulation of NF-κB signaling pathways [33]. Similar increases in IL-1 and IL-6 expression have been observed in PBMCs from patients with immune-mediated hearing loss (IMHL) stimulated with the SARS-CoV-2 spike protein at 12 ng/mL [34]. Prior ex vivo studies also indicate that the spike protein acts synergistically with low-dose LPS to enhance TNF- and IL-1 production [35]. Additionally, in silico studies have reported that the SARS-CoV-2 spike protein can bind not only to the angiotensin-converting enzyme 2 receptor but also to TLR4, a key receptor for lipopolysaccharide, potentially intensi­fying downstream inflammatory signaling [36]. However, receptor engagement and downstream pathway activation were not directly assessed in the present study; therefore, these mechanisms should be interpreted as literature-supported hypotheses rather than confirmed findings.

To induce a hyperinflammatory state, lipopoly­saccharide (LPS) was added to the culture medium to stimulate the innate immune response in PBMCs. LPS, a structural component of Gram-negative bacteria, a potent activator of the innate immune system and widely used in experimental models of inflammation because it mimics cytokine-mediated inflammatory responses. Upon interaction with innate immune cells, particularly monocytes and macro­phages, LPS stimulates the production of proinflam­matory cytokines and chemokines, thereby contri­buting to host defense mechanisms [37]. Toll-like receptor 4 (TLR4) is the primary receptor for LPS recognition and signal transduction. Binding of LPS to TLR4 activates NF-κB through recruitment and activation of MyD88, IL-1 receptor–associated ki­nase (IRAK), TNF receptor-associated factor 6 (TRAF6), and NADPH oxidase (Nox). NF-κB plays a central role in regulating the transcription of genes related to innate immunity and inflammatory responses [24].

Our results showed that PBMCs stimulated with LPS at 10 ng/mL had the greatest increase in IL-6 mRNA expression (Fig. 2, c). These findings align with previous studies showing that LPS stimulates the production of proinflammatory cytokines and chemo­kines in innate immune cells. Even low concen­trations of LPS have been shown to induce IL-6 and TNF-α production [37].

Activity of dexamethasone or Phaleria macro­carpa fruit extract on IL-6 expression in lipopo­lysaccharide-induced conditions

In the lipopolysaccharide-induced model (10 ng/mL), dexamethasone reduced IL-6 mRNA expression, with the greatest reduction at 50 ng/mL (Fig. 3, a). This effect is consistent with the known ability of glucocorticoids to suppress inflammatory gene transcription [38]. However, glucocorticoid re­ceptor signaling and nuclear factor-κB (NF-κB) acti­va­tion were not directly measured in this experiment.

Treatment with Phaleria macrocarpa fruit ex­tracts at several concentrations after LPS stimulation at 10 ng/mL generally reduced IL-6 mRNA expres­sion compared with the stimulated control (Fig. 3, b). However, the pattern was not entirely consistent. This variability may be attributable to the complex and heterogeneous chemical composition of herbal extracts, in which observed effects may result from the combined interactions of multiple constituents [39]. Therefore, these findings should be interpreted as a preliminary indication of an IL-6 mRNA-suppressive signal, suggesting that Phaleria macro­carpa fruit extract contains components that may attenuate LPS-induced IL-6 upregulation.

Cell viability assessment and determination of non-cytotoxic conditions

To confirm that changes in inflammatory markers were unaffected by the treatment's cytotoxic effects, cell viability was evaluated under the designated inflammatory stimulation and treatment conditions. The stimulatory agents (glucose, SARS-CoV-2 spike protein, and lipopolysaccharides) and the treatment agents (dexamethasone and Phaleria macrocarpa fruit extract) were assessed for their effects on PBMC viability. None of the treatments showed a significant reduction in cell viability compared with the control cells, and the average cell viability remained above 80% (Fig. 4).

The results suggest that the stimulation treatments used in subsequent analysis were unlikely to account for the observed effects on IL-6, indicating that these effects were unlikely to result from a significant loss of viable cells.

Suppression of IL-6 mRNA expression by Pha­leria macrocarpa extracts in the combined spike protein and lipopolysaccharide model under high-glucose conditions

Figure 5 addresses the central objective of estab­lishing an inflammatory model that incorporates both infection-associated stimuli and a high-glucose con­dition, and then applying it to the early screening of drug candidates.

Hyperglycemia is a common feature of poorly controlled diabetes, prompting investigation into how immune cells pre-exposed to elevated glucose levels respond to inflammatory stimuli. A previous study modeled this clinical context by pre-incubating PBMCs with graded glucose concentrations (5.5, 8, 16, and 24 mM) for 48 h, followed by stimulation with the TLR3 agonist poly(I: C) (20 µg/mL) for an additional 24 h. Hyperglycemia has been reported to increase proinflammatory cytokine production while impairing type I interferon generation and signaling, mechanisms that may exacerbate inflammatory res­ponses and weaken antimicrobial defenses in diabetes [40].

Additionally, hyperglycemia has been reported to predispose monocytes/macrophages to a proinflam­matory phenotype by increasing oxidative stress and enhancing NF-κB signaling, thereby intensifying responses to toll-like receptor 4 (TLR4) ligands, including lipopolysaccharide [40]. The combined use of high glucose, the SARS-CoV-2 spike protein, and lipopolysaccharide is therefore a biologically plausible experimental model of hyperglycemia, in which chronic metabolic stress may lower the threshold for cytokine production. However, the model should not be considered a full replication of diabetes-associated COVID-19 hyperinflammation.

Consistent with the above concept, increasing in vitro glucose concentrations from 5 to 25 mmol/L had only marginal effects on cytokine release after stimu­lation with M. tuberculosis lysate, LPS, or Candida albicans. In contrast, exposure to 40 mmol/L glucose markedly increased production of TNF-α, IL-1β, IL-6, and IL-10. Notably, IL-6 and IL-1β increased in a dose-dependent manner, whereas T-cell–derived cytokines showed greater variability. Collectively, these findings support the concept that substantial hyperglycemia can amplify inflammatory signaling in immune cells [41].

Stimulation with the SARS-CoV-2 spike protein in combination with LPS under high-glucose con­ditions resulted in elevated IL-6 expression compared with PBMCs maintained in control medium. These findings suggest that elevated glucose may enhance IL-6 mRNA responses to infectious or inflammatory stimuli in this experimental system. The observed response is consistent with the previous literature on spike protein-LPS interaction [42]. However, because nuclear factor kappa B (NF-kB), TLR4, MAPK, and related pathways were not directly measured, the mechanism cannot be confirmed by the present data. Treatment with the Phaleria macrocarpa fruit ethanol extract resulted in concentration-dependent suppression of IL-6 expression in the inflammatory PBMC model. This attenuation was comparable to that of dexamethasone, the positive control, thereby substantiating the preliminary data indicating that Phaleria macrocarpa fruit extract may inhibit IL-6 expression under the combined condition.

Taken together, these results (Fig. 5) demonstrate that the ethanol extract reduced IL-6 mRNA expres­sion induced by the SARS-CoV-2 spike protein and LPS under high-glucose conditions. This finding aligns with prior reports that P. macrocarpa contains bioactive constituents, such as alkaloids, flavonoids, phenolics, sterols, and terpenoids, which may inhibit IL-6 production and therefore possess potential anti-inflammatory activity relevant to inflammation associated with viral infections and hyperglycemia [43-46]. However, the present study did not identify which constituent was responsible for the observed effect and did not assess IL-6 at the protein level.

Our findings support the feasibility of a peripheral blood mononuclear cell inflammatory platform in­corporating high-glucose exposure. SARS-CoV-2 spike protein and lipopolysaccharide, when combined with high-glucose exposure, enhanced inflammatory responses. Additionally, initial evidence suggests that Phaleria macrocarpa fruit ethanol extract may re­duce IL-6 mRNA expression in this system. Dexa­methasone, used as a control, produced a similar suppression of IL-6 mRNA expression, consistent with its known anti-inflammatory pharmacology [38]. However, comparisons with dexamethasone should be interpreted with caution because only IL-6 mRNA expression was measured, and no protein-level or pathway-specific validation was performed. 

The present study remains an early-stage explo­ratory experiment because its primary endpoint is a single messenger of RNA marker. To improve mechanistic and translational relevance, subsequent studies should validate effects at the protein level, such as IL-6 concentrations in the supernatant; in­corporate additional inflammatory mediators, inclu­ding TNF-α, IL-1β, interferon responses, and oxida­tive stress markers; and improve the interpretability of extracts through analytical standardization and/or  fractionation.

The fruit of Phaleria macrocarpa contains phenolic and flavonoid compounds, including man­giferin and phalerin, that have been reported to influence inflammatory signaling and oxidative stress in preclinical studies [12, 29, 31]. The current study did not identify a single active constituent. Therefore, any proposed involvement of upstream pathways, such as NF-κB or mitogen-activated protein kinase cascades, remains hypothetical and should be tested directly in future work using pathway-specific assays [47]. Chemical standardization, such as high-per­formance liquid chromatography profiling, will be crucial for ensuring repeatability and facilitating future translation.

From a translational standpoint, the use of primary human immune cells offers advantages over immor­talized cell lines; however, inter-donor variability and limited biological replicates pose significant limi­tations. This study has several limitations. First, PBMCs were obtained from only two healthy female donors; therefore, donor-to-donor variability, sex-related immune differences, and generalizability could not be adequately assessed. Second, IL-6 mRNA expression was the sole inflammatory end­point, and no other inflammatory markers, such as TNF-α, IL-1β, or interferons, were measured. Finally, the findings are based on an in vitro model and should not be interpreted as evidence of clinical efficacy in COVID-19, diabetes, or diabetes-associated hyperin­flammation.  Subsequent research should involve a broader, more heterogeneous donor population, pro­tein-level multiplex cytokine assays, and an expanded endpoint panel and functional pathways.

CONCLUSIONS

1. This exploratory study established an in vitro inflammatory model using human peripheral blood mononuclear cells exposed to elevated glucose levels, subsequently stimulated with the Severe Acute Respiratory Syndrome Coronavirus-2 spike protein and lipopolysaccharides, with interleukin-6 mRNA expression as the primary marker of effect. 

2. Phaleria macrocarpa fruit ethanol extract reduced the interleukin-6 mRNA expression at non-cytotoxic concentrations under the tested conditions. Due to the limited number of PBMC donors, this data should be considered preliminary.

3. A subsequent study using a larger, sex-balanced donor population, broader anti-inflammatory end­points, and chemical standardization is needed before this cell-based platform can be applied to screen anti-inflammatory candidates under conditions of elevated glucose exposure.

Contributors:

Nurhasanah A.H. – data curation, formal analysis, writing original draft;

Louisa M. – conceptualization, methodology, su­pervision, review & editing;

Angelina M. – validation, supervision, review & editing;

Estuningtyas A. – validation, review & editing.

Funding. This research was funded by the Master Thesis Research Grant of the Ministry of Higher Education, Science and Technology, Re­public of Indo­nesia 2025 (Contract no. PKS-597/UN2/RST/HKP.05.00/2025) and Program Center of the Health Research Organization, Na­tional Research and Innovation Agency (Decision of the Head of The Health Research Organization, BRIN, No. 72/III.9/HK/2025).

Conflict of interests. The authors declare no conflict of interest.

REFERENCES

1. Carbajal J, Ballon‑Salcedo C, Uribe‑Cavero L, Saravia G, Cuadros‑Aguilar S, Lopez M, et al. Risk factors associated with the mortality of COVID‑19 in patients with type 2 diabetes mellitus. World Acad Sci J. 2024;6:62. doi: https://doi.org/10.3892/wasj.2024.277

2. Sharma P, Behl T, Sharma N, Singh S, Gre­wal AS, Albarrati A, et al. COVID-19 and diabetes: Asso­ciation intensify risk factors for morbidity and mortality. Biomed Pharmacother. 2022;151:113089. doi: https://doi.org/10.1016/j.biopha.2022.113089

3. Zhou Q, Zhang L, Dong Y, Wang Y, Zhang B, Zhou S, et al. The role of SARS-CoV-2-mediated NF-κB activation in COVID-19 patients. Hypertension Res. 2024;47:375-84. doi: https://doi.org/10.1038/s41440-023-01460-2  

4. Hiti L, Markovič T, Lainscak M, Farkaš Lain­ščak J, Pal E, Mlinarič-Raščan I. The immunopathogenesis of a cytokine storm: The key mechanisms underlying severe COVID-19. Cytokine Growth Factor Rev. 2025;82:1-17. doi: https://doi.org/10.1016/j.cytogfr.2024.12.003

5. Sharun K, Tiwari R, Dhama J, Dhama K. Dexa­methasone to combat cytokine storm in COVID-19: Clinical trials and preliminary evidence. Int J Surgery. 2020;82:179-81. doi: https://doi.org/10.1016/j.ijsu.2020.08.038 

6. Tuba S, Aprianto MR. Effectivity of Dexa­methasone Fighting Cytokine Storm in Severe COVID-19 Patients; Does it still reliable used for COVID-19? Formosa J Sci Tech. 2022;1:157-64. doi: https://doi.org/10.55927/fjst.v1i3.835

7. Landstra CP, de Koning EJP. COVID-19 and Diabetes: Understanding the Interrelationship and Risks for a Severe Course. Front Endocrinol (Lausanne). 2021 Jun 17;12:649525. doi: https://doi.org/10.3389/fendo.2021.649525

8. RECOVERY Collaborative Group. Dexa­metha­sone in Hospitalized Patients with COVID-19. New Engl J Med. 2021;384:693-704. doi: https://doi.org/10.1056/NEJMoa2021436

9. Arcani R, Cauchois R, Suchon P, Jean R, Jarrot P, Gomes De Pinho Q, et al. Factors associated with dexa­methasone efficacy in COVID‐19. A retrospective inves­tigative cohort study. J Med Virol. 2022;94:3169-75. doi: https://doi.org/10.1002/jmv.27712

10. Ghasemian M, Owlia S, Owlia MB. Review of Anti-Inflammatory Herbal Medicines. Adv Pharmacol Sci. 2016;2016:1-11. doi: https://doi.org/10.1155/2016/9130979

11. Gupta M, Singh N, Gulati M, Gupta R, Sudha­kar K, Kapoor B. Herbal bioactives in treatment of inflammation: An overview. South Afr J Botany. 2021;143:205-25. doi: https://doi.org/10.1016/j.sajb.2021.07.027

12. Hendra R, Ahmad S, Oskoueian E, Sukari A, Shu­kor MY. Antioxidant, Anti-inflammatory and Cyto­toxicity of Phaleria macrocarpa (Boerl.) Scheff Fruit. BMC Complement Altern Med. 2011;11:110. doi: https://doi.org/10.1186/1472-6882-11-110

13. Ahmad R, Khairul Nizam Mazlan M, Firdaus Abdul Aziz A, Mohd Gazzali A, Amir Rawa MS, Wahab HA. Phaleria macrocarpa (Scheff.) Boerl.: An updated review of pharmacological effects, toxicity studies, and separation techniques. Saudi Pharm J. 2023;31:874-88. doi: https://doi.org/10.1016/j.jsps.2023.04.006

14. Lestari I, Lindarto D, Ilyas S, Widyawati T, Mus­tofa M, Jusuf N, et al. Effect of Phaleria Macrocarpa (Scheff.) Boerl Leaf Ethanol Extract on Serum IL-6 and TNF-α Levels in Diabetic Rats. Med Archiv. 2023;77:254. doi: https://doi.org/10.5455/medarh.2023.77.254-257

15. Heriatmo NL, Estuningtyas A, Soetikno V, Poer­waningsih EH, Kusmardi K. Attenuation of TNF-α and Iron Levels in Renal Hemosiderosis by Phaleria macrocarpa (Scheff.) Boerl Extract in a Rat Iron Overload Model. Indones J Pharm. 2024;35(3):481-90. doi: https://doi.org/10.22146/ijp.6811

16. Petruk G, Puthia M, Petrlova J, Samsudin F, Strömdahl A-C, Cerps S, et al. SARS-CoV-2 spike protein binds to bacterial lipopolysaccharide and boosts proin­flammatory activity. J Mol Cell Biol. 2021;12:916-32. doi: https://doi.org/10.1093/jmcb/mjaa067

17. Hansur L, Louisa M, Ernawaty B, Wuyung PE, Zaini J, Fadillah F, et al. Histopathology assay of the lung after intratracheal injection of SARS-CoV-2 spike protein recombinant in mice: A preliminary study. AIP Conf Proc. 2024;3080:090002. doi: https://doi.org/10.1063/5.0199399

18. Hansur L, Louisa M, Wuyung PE, Fadilah F. Daphnoretin from Carthamus tinctorius as a Potential Inflammatory Inhibitor in COVID-19 by Binding to Toll-like Receptor-4: An in silico Molecular Docking Study. Open Access Maced J Med Sci. 2022;10:220-7. doi: https://doi.org/10.3889/oamjms.2022.7961

19. Melgaço JG, Azamor T, Silva AMV, Linha­res JHR, dos Santos TP, Mendes YS, et al. Two-Step In Vitro Model to Evaluate the Cellular Immune Response to SARS-CoV-2. Cells. 2021;10:2206. doi: https://doi.org/10.3390/cells10092206

20. Nichols JH, Smith AM, Jonsson CB. The Inter­section of SARS-CoV-2 and Diabetes. Microorganisms. 2025;13:1390. doi: https://doi.org/10.3390/microorganisms13061390

21. Abubakar AR, Haque M. Preparation of medicinal plants: Basic extraction and fractionation procedures for experimental purposes. J Pharm Bioallied Sci. 2020;12:1-10. doi: https://doi.org/10.4103/jpbs.JPBS_175_19

22. Rizki M, Harahap U, Sitorus P. Phytochemical Screening Of Phaleria Macrocarpa (Scheff.) Boerl.) And Antibacterial Activity Test Of Ethanol Extract Against Staphylococcus Aureus Bacteria. Int J Sci Tech Mana­gement. 2023;4:422-7. doi: https://doi.org/10.46729/ijstm.v4i2.781

23. Čolić M, Bekić M, Tomić S, Đokić J, Ra­doje­vić D, Šavikin K, et al. Immunomodulatory Properties of Pomegranate Peel Extract in a Model of Human Peripheral Blood Mononuclear Cell Culture. Phar­maceutics. 2022;14:1140. doi: https://doi.org/10.3390/pharmaceutics14061140

24. Ngkelo A, Meja K, Yeadon M, Adcock I, Kir­kham PA. LPS induced inflammatory responses in human peripheral blood mononuclear cells is mediated through NOX4 and G iα dependent PI-3kinase signalling. J Inflamm. 2012 Jan 12;9(1):1. doi: https://doi.org/10.1186/1476-9255-9-1

25. Livak K, Schmittgen T. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402-8. doi: https://doi.org/10.1006/meth.2001.1262

26. Agustin E, Insanu M, Mauludin R. Improvement in Pharmacological Activity of Mahkota Dewa (Phaleria macrocarpa (Schef. Boerl)) Seed Extracts in Nanoemulsion Dosage Form: In vitro and In vivo Studies. Pharm Nanotechnol. 2024;12:90-7. doi: https://doi.org/10.2174/2211738511666230602100045

27. Shofiah A, Christina YI, Dwijayanti DR, Soe­wondo A, Widodo N, Djati MS. Exploring the inflam_matory pathway modulation of Phaleria macrocarpa: evidence from in vitro and in silico studies. Pharmacia. 2025;72:1-14. doi: https://doi.org/10.3897/pharmacia.72.e153095

28. Rizki M, Harahap U, Sitorus P. Phytochemical Screening of Phaleria macrocarpa (Scheff.) Boerl.) and Antibacterial Activity Test of Ethanol Extract Against Staphylococcus aureus Bacteria. Int J Sci Technol Management. 2023;4:422-7. doi: https://doi.org/10.46729/ijstm.v4i2.781

29. Oshimi S, Zaima K, Matsuno Y, Hirasawa Y, Iizu­ka T, Studiawan H, et al. Studies on the constituents from the fruits of Phaleria macrocarpa. J Nat Med. 2008;62:207-10. doi: https://doi.org/10.1007/s11418-007-0209-9

30. Ali RB, Atangwho IJ, Kaur N, Abraika OS, Ah­mad M, Mahmud R, et al. Bioassay-Guided Antidiabetic Study of Phaleria macrocarpa Fruit Extract. Molecules. 2012;17:4986-5002. doi: https://doi.org/10.3390/molecules17054986

31. Altaf R, Asmawi M Bin, Dewa A, Sadikun A, Umar M. Phytochemistry and medicinal properties of Pha­leria macrocarpa (Scheff.) Boerl. extracts. Pharmacogn Rev. 2013;7:73. doi: https://doi.org/10.4103/0973-7847.112853

32. Lestari IC, Ghufron M, Herwiyanti S, Ari Su­miwi YA. The effects of ethanolic extract of Phaleria macrocarpa (Scheff.) Boerl leaf on macrophage phagocytic activity in diabetic rat model. J Med Sci. 2018;50:140-9. doi: https://doi.org/10.19106/JMedSci005002201802

33. Olajide OA, Iwuanyanwu VU, Lepiarz‐Raba I, Al‐Hindawi AA, Aderogba MA, Sharp HL, et al. Garcinia kola and garcinoic acid suppress SARS‐CoV‐2 spike glycoprotein S1‐induced hyper‐inflammation in human PBMCs through inhibition of NF‐κB activation. Phytother Res. 2021;35:6963-73. doi: https://doi.org/10.1002/ptr.7315

34. Pathak S, Tan N, Vambutas A. A pilot study on the effect of SARS-CoV-2 spike protein on IL-1β-mediated inflammation in peripheral blood immune cells from AIED patients. Mol Med. 2025;31:174. doi: https://doi.org/10.1186/s10020-025-01227-0

35. Tumpara S, Gründing AR, Sivaraman K, Wren­ger S, Olejnicka B, Welte T, et al. Boosted Pro-Inflam­matory Activity in Human PBMCs by Lipopolysaccharide and SARS-CoV-2 Spike Protein Is Regulated by α-1 Antitrypsin. Int J Mol Sci. 2021;22:7941. doi: https://doi.org/10.3390/ijms22157941

36. Bhattacharya M, Sharma AR, Mallick B, Shar­ma G, Lee S-S, Chakraborty C. Immunoinformatics ap­proach to understand molecular interaction between multi-epitopic regions of SARS-CoV-2 spike-protein with TLR4/MD-2 complex. Infect Genet Evol. 2020;85:104587. doi: https://doi.org/10.1016/j.meegid.2020.104587

37. Chaiwut R, Kasinrerk W. Very low concentration of lipopolysaccharide can induce the production of various cytokines and chemokines in human primary monocytes. BMC Res Notes. 2022 Feb 10;15(1):42. doi: https://doi.org/10.1186/s13104-022-05941-4

38. Świerczek A, Jusko WJ. Pharmacokinetic/Phar­macodynamic Modeling of Dexamethasone Anti-Inflam­matory and Immunomodulatory Effects in LPS-Chal­lenged Rats: A Model for Cytokine Release Syndromes. J Pharmacol Exp Ther. 2023;384:455-72. doi: https://doi.org/10.1124/jpet.122.001477

39. Kiyomi A, Matsuda A, Nara M, Yamazaki K, Imai S, Sugiura M. Immunological Differences in Human Pe­ripheral Blood Mononuclear Cells Treated with Tradi­tional Japanese Herbal Medicines Hochuekkito, Juzen­taihoto, and Ninjin’yoeito from Different Pharmaceutical Companies. Evidence-Based Compl Altern Med. 2021;2021:7605057. doi: https://doi.org/10.1155/2021/7605057

40. Hu R, Xia CQ, Butfiloski E, Clare-Salzler M. Effect of high glucose on cytokine production by human peripheral blood immune cells and type I interferon signaling in monocytes: Implications for the role of hyperglycemia in the diabetes inflammatory process and host defense against infection. Clin Immunol. 2018;195:139-48. doi: https://doi.org/10.1016/j.clim.2018.06.003

41. Lachmandas E, Vrieling F, Wilson LG, Joos­ten SA, Netea MG, Ottenhoff TH, et al. The effect of hyperglycaemia on in vitro cytokine production and macrophage infection with mycobacterium tuberculosis. PloS One. 2015 Feb 9;10(2):e0117941. doi: https://doi.org/10.1371/journal.pone.0117941

42. Petruk G, Puthia M, Petrlova J, Samsudin F, Strömdahl AC, Cerps S, et al. SARS-CoV-2 spike protein binds to bacterial lipopolysaccharide and boosts pro­inflammatory activity. J Mol Cell Biol. 2020;12:916-32. doi: https://doi.org/10.1093/jmcb/mjaa067

43. Ahmad R, Khairul Nizam Mazlan M, Firdaus Abdul Aziz A, Mohd Gazzali A, Amir Rawa MS, Wahab HA. Phaleria macrocarpa (Scheff.) Boerl.: An updated review of pharmacological effects, toxicity studies, and separation techniques. Saudi Pharm J. 2023;31:874-88. doi: https://doi.org/10.1016/j.jsps.2023.04.006

44. Lestari IC, Ghufron M, Herwiyanti S, Ari Sumi­wi YA. The effects of ethanolic extract of Phaleria mac­rocarpa (Scheff.) Boerl leaf on macrophage phagocytic activity in diabetic rat model. J Med Sci. 2018;50:140-9. doi: https://doi.org/10.19106/jmedsci005002201802

45. Kusmardi K, Situmorang NY, Zuraidah E, Estu­ningtyas A, Tedjo A. The effect of mahkota dewa (Phaleria macrocarpa) leaf extract on the Mucin 1 expression in mice colonic epithelial cells induced by dextran sodium sulfate (DSS). Pharmacogn J. 2021;13:1509-15. doi: https://doi.org/10.5530/pj.2021.13.192

46. Ali R, Atangwho I, Kaur N, Abraika O. Bioassay-Guided Antidiabetic Study of Phaleria macrocarpa Fruit Extract. Molecules. 2012;17:4986-5002. doi: https://doi.org/10.3390/molecules17054986

47. Millrine D, Jenkins RH, Hughes STO, Jones SA. Making sense of IL‐6 signalling cues in pathophysiology. FEBS Lett. 2022;596:567-88. doi: https://doi.org/10.1002/1873-3468.14201