Деталі

Перегляди: 231

Key words: hyperglycemia, inflammation, interleukin-6, peripheral blood mononuclear cells, type-2 diabetes mellitus

Ключові слова: гіперглікемія, запалення, інтерлейкін-6, мононуклеарні клітини периферичної крові, цукровий діабет 2 типу

Abstract

Type 2 diabetes mellitus is a significant risk factor for dysregulated inflammatory responses during Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) infection. Corticosteroids, commonly used as anti-inflammatory agents in diabetic patients, often cause hyperglycemia, making infections and inflammation more difficult to control. These conditions highlight the need for laboratory models that can support preliminary screening of anti-inflammatory drug candidates under elevated-glucose conditions. This exploratory study aimed to establish a human peripheral blood mononuclear cell (PBMC) inflammatory model induced by SARS-CoV-2 and lipopolysaccharide in the presence of high glucose and to assess the modulatory activity of Phaleria macrocarpa fruit ethanol extract on interleukin-6 (IL-6) mRNA expression under combined stimulation. This in vitro study used a human PBMC model induced by the SARS-CoV-2 spike protein and lipopolysaccharide under elevated glucose conditions. PBMCs were isolated from venous blood of a limited number of healthy adult volunteers. The concentrations of glucose, SARS-CoV-2 spike protein, and lipopolysaccharides used in PBMC cultures were selected for their ability to increase IL-6 mRNA expression under the tested conditions. Non-cytotoxic concentrations of Phaleria macrocarpa fruit ethanol extract were identified by maintaining cell viability of at least 80 percent. Combined stimulation with the SARS-CoV-2 spike protein, lipopolysaccharide, and high glucose increased IL-6 mRNA expression. Treatment with Phaleria macrocarpa fruit ethanol extract was comparable with dexamethasone in reducing IL-6 mRNA expression under the combined stimulation condition. These preliminary findings suggest that Phaleria macrocarpa suppresses IL-6 mRNA expression in response to combined stimulation in this in vitro PBMC model. However, our findings should be interpreted as exploratory due to the small number of the PBMC donor pool. Further studies using a larger, sex-balanced donor population, broader cytokine panels, and chemical standardization are required. 

Реферат

Пошукове дослідження впливу екстракту плодів Phaleria macrocarpa на експресію мРНК інтерлейкіну-6 у мононуклеарних клітинах периферичної крові людини, індукованих spike-білком SARS-CoV-2 та ліпополісахаридом в умовах підвищеного рівня глюкози in vitro. Нурхасанах А.Г., Луїса М., Ангелина М., Естунінгтіяс А. Цукровий діабет 2-го типу є значущим фактором ризику розвитку порушених запальних реакцій під час інфекції, спричиненої вірусом Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2). Кортикостероїди, які широко застосовуються як протизапальні засоби в пацієнтів з діабетом, часто викликають гіперглікемію, що ускладнює контроль інфекційних і запальних процесів. Ці обставини зумовлюють потребу у створенні лабораторних моделей для попереднього скринінгу потенційних протизапальних лікарських засобів в умовах підвищеної концентрації глюкози. Метою цього пошукового дослідження було створення запальної моделі на основі мононуклеарних клітин периферичної крові людини (peripheral blood mononuclear cell, PBMCs), індукованої SARS-CoV-2 та ліпополісахаридом за умов високого рівня глюкози, а також оцінювання модулювальної активності етанольного екстракту плодів Phaleria macrocarpa щодо експресії мРНК (матрична РНК) інтер­лейкіну-6 (interleukin-6, IL-6) за комбінованої стимуляції. У дослідженні in vitro використовували модель людських PBMCs, стимульованих spike-білком SARS-CoV-2 та ліпополісахаридом в умовах підвищеної концентрації глюкози. PBMCs виділяли з венозної крові обмеженої кількості здорових дорослих добровольців. Концентрації глюкози, spike-білка SARS-CoV-2 та ліпополісахариду для культивування PBMCs підбирали на основі їхньої здатності підви­щу­вати експресію мРНК IL-6 за досліджуваних умов. Нетоксичні концентрації етанольного екстракту плодів Pha­leria macrocarpa визначали шляхом забезпечення життєздатності клітин на рівні не менше 80%. Ком­бінована стимуляція spike-білком SARS-CoV-2, ліпополісахаридом та високою концентрацією глюкози спричиняла підви­щення експресії мРНК IL-6. Вплив етанольного екстракту плодів Phaleria macrocarpa щодо зниження експресії мРНК IL-6 за умов комбінованої стимуляції був зіставним з ефектом дексаметазону. Отримані попередні резуль­тати свідчать, що Phaleria macrocarpa пригнічує експресію мРНК IL-6 у відповідь на комбіновану сти­муляцію в цій моделі PBMCs in vitro. Водночас результати слід розглядати як пошукові через невелику кількість донорів PBMCs. Для підтвердження отриманих даних необхідні подальші дослідження із залученням більшої та гендерно збалансованої популяції донорів, ширших панелей цитокінів і проведенням хімічної стандартизації екстракту.

Individuals with type 2 diabetes mellitus (T2DM) face a higher risk of developing severe coronavirus disease 2019 (COVID-19) and have higher mortality rates compared to non-diabetic individuals. Although the exact mechanisms underlying greater severity in diabetic patients are not fully understood, both con­ditions involve dysregulated immune and inflam­matory responses [1, 2]. A key feature of severe COVID-19 is the cytokine storm, which causes vascular hyperpermeability, multiorgan failure, and death. In severe cases, there is an overproduction of proinflammatory cytokines and chemokines, along with a limited induction of interferons (IFN-α, IFN-β, and IFN-γ). Increased interferon production activates nuclear factor kappa light chain enhancer of activated B cells (NF-κB), a crucial mediator of in­flammatory responses. When activated, NF-κB trans­lo­cates to the nucleus, leading to increased production of proinflammatory molecules, including interleukin-6 (IL-6). IL-6 is a key biomarker of COVID-19-related cytokine storms and is inversely associated with immune function impairment [3, 4].

Current therapeutic strategies recommended by the World Health Organization (WHO) for managing hyperinflammation include corticosteroids such as dexamethasone; however, their effectiveness remains limited [5, 6]. Additionally, severe COVID-19 and its steroid-based treatments can negatively impact diabetes management by worsening hyperglycemia through increased insulin resistance and impaired β-cell secretory function. In turn, uncontrolled hyper­glycemia may further increase COVID-19 severity [7]. High-dose dexamethasone is also associated with significant adverse effects [7, 8, 9]. These limitations highlight the need for complementary strategies that can reduce hyperinflammation while minimizing risks in patients with metabolic comorbidities.

Natural products remain an important source of potential anti-inflammatory agents [10, 11]. One known natural product is Phaleria macrocarpa fruit, which has been reported to possess various bioactive properties, including antioxidant, antidiabetic, antiviral, anti-inflammatory, and immunomodulatory activities [12-15]. However, its anti-inflammatory activity has not been thoroughly evaluated in a human immune cell hyperinflammatory model with in­creased glucose exposure, a context relevant to diabetes-related vulnerability.

Previous mechanistic studies indicate that the Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) spike protein can enhance inflam­matory responses to lipopolysaccharide (LPS), a well-established toll-like receptor 4 (TLR4) ligand, thereby increasing proinflammatory cellular respon­ses both in vitro and in vivo [16, 17, 18]. Evidence also suggests that higher glucose exposure may amplify immune cell inflammatory responses. There­fore, a peripheral blood mononuclear cell model that combines increased glucose exposure with stimu­lation by the spike protein and lipopolysaccharide could serve as a practical platform for early screening of potential anti-inflammatory interventions [19, 20]. Given its known pharmacological properties, P. mac­rocarpa was selected for preliminary evaluation in this model, with IL-6 mRNA expression used as the primary inflammatory marker. 

This study aimed to establish an exploratory model of inflammatory peripheral blood mono­nuclear cells (PBMCs) under high-glucose exposure by sequential stimulation with SARS-CoV-2 spike protein and lipopolysaccharide, and to evaluate whether an ethanol extract of Phaleria macro­carpa fruit modulates the induced IL-6 mRNA response.

MATERIALS AND METHODS OF RESEARCH

This study adhered to the Declaration of Helsinki and was approved by the Institutional Ethics Committee of the Faculty of Medicine, Universitas Indonesia (No. KET-1415/UN2.F1/ETIK/PPM.00.02/2025). Written informed consent was obtained for partici­pation and PBMC sample collection.

Plant collection and extract preparation

The dried fruit of Phaleria macrocarpa was obtained from a sample collected by the National Research and Innovation Agency (BRIN). The plant determination was done by the Traditional Medicine Raw Material Standardization Laboratory, BRIN (Voucher Number: 6449-244096-1).

Approximately 166.8 g of the powdered sample was sequentially extracted by maceration in 70% ethanol for 4 days at ambient temperature, with periodic shaking. The extract was then concentrated under reduced pressure using a rotary evaporator (Buchi Laboratorium-Technik AG, Flawil, Switzer­land) at 45°C until all solvent was removed, yielding the dried crude extract.

Phytochemical analysis

The bioactive compounds of the Phaleria macro­carpa fruit extract were analyzed using phytoche­mical screening. The test procedures involved the examination of alkaloids, phenols, flavonoids, saponins, tannins, and terpenoids [21, 22].

High-performance liquid chromatography (HPLC) analysis

HPLC analysis was performed to confirm the presence of phalerin and mangiferin as markers for Phaleria macrocarpa fruit ethanol extracts. The study was conducted using a Waters HPLC 2695 Alliance system equipped with a photodiode array detector (2998). Chromatographic separation was achieved on a Symmetry C18 column. Sample solutions were filtered through a 0.22 μm membrane filter and injected into the column in a 30 μL volume. For phalerin, isocratic separation was performed using acetonitrile and water (63:35, v/v) as the mobile phase at 35^°C, a flow rate of 0.9 mL/min, and detection at 220 nm. Mangiferin analysis was conducted using a mobile phase consisting of methanol and 0.5% formic acid (30:70, v/v). The chromatographic conditions were as follows: column temperature, 40^°C^; flow rate, 1.0 mL/min; and detection at 257 nm [18, 19].

PBMC isolation

Human peripheral blood mononuclear cells were isolated from venous blood of healthy adult volunteers. Eligibility criteria for donors were healthy men or women aged 18-45 years, blood group O, who received at least two doses of the COVID-19 vaccine. Individuals with confirmed diabetes mellitus were excluded. PBMCs were obtained from two healthy female donors. Three experimental replicates were performed and should be interpreted as technical replicates. A blood volume of 15 mL was collected from each donor at each collection.

Whole blood was diluted 1:1 with cold Dulbecco's phosphate-buffered saline (DPBS, Gibco, Cat No. 14190-144) and layered over an equal volume of density-gradient medium (Ficoll-Paque^TM PLUS, Cytiva, Cat No. 17144003) [13]. Samples were centri­fuged at 2,500 rpm for 30 minutes. The PBMC layer was collected, washed twice with cold Dulbecco's phosphate-buffered saline (DPBS, and centrifuged at 1,200 rpm for an additional 10 minutes at room temperature. The isolated pellets were resuspended in 1 mL of cold DPBS. Cell count was determined using a hemocytometer, and viability was assessed by trypan blue exclusion. Samples with >90% viability were selected for downstream experiments [23].

PBMC culture, glucose conditioning, and hyper­inflammatory stimulation

PBMCs were cultured in complete medium consisting of RPMI-1640 (Gibco, Cat No. 11875-093) supplemented with 10% heat-inactivated fetal bovine serum (Sigma-Aldrich, Cat No. F9665) and 1% penicillin-streptomycin (Sigma-Aldrich, Cat No. P4333). Cells were incubated for 2 h at 37°C in a humidified 5% CO₂ atmosphere. Afterward, adherent cells were separated from the non-adherent ones [24]. Adherent PBMCs were seeded at a density of 1.5×10⁶ cells per well in high-glucose medium and incubated overnight.

PBMCs were cultured in high-glucose medium conditioned for 2 hours by supplementing the culture media with glucose at 5.5, 15, 25, or 30 mM. The resulting glucose concentrations in culture super­natants were measured spectrophotometrically at 500 nm using the Glucose GOD FS assay (DiaSys, Cat. No. 1 2500 99 83 021). Based on these measu­rements and the corresponding IL-6 mRNA response, 15 mM glucose supplementation was selected for subsequent experiments.

To induce a hyperinflammatory condition, adhe­rent PBMCs were subsequently stimulated with SARS-CoV-2 spike protein (RayBiotech, Cat No. 30-01101-10) for 2 hours, followed by lipopo­lysaccharide (LPS) (Sigma-Aldrich, Cat No. L2880) at 10 ng/mL for 24 hours. Spike protein exposure was maintained during the LPS phase. An overview of the study workflow is presented in Figure 1.

Treatment with Phaleria macrocarpa extract

Adherent PBMCs were treated with varying concentrations of Phaleria macrocarpa fruit ethanol extract (12.5, 25, and 50 mg/mL) or dexamethasone (50 mg/mL) for 24 hours. Dexamethasone (Infalabs, B0120206) served as a positive anti-inflammatory control. Vehicle controls contained dimethylsul­foxi­de (Sigma-Aldrich, Cat No. D2650) at the same final concentrations as treatment groups. Phaleria macro­carpa fruit extracts or dexamethasone were added after sequential PBMC stimulation with SARS-CoV-2 spike protein and lipopolysaccharides (Fig. 1).

Interleukin-6 mRNA gene expression

For gene expression analysis, cells were harvested after 24 h, and total RNA was isolated using the Quick-RNA™ Miniprep Plus Kit (Zymo Research, Cat No. R1058). Total RNA was reverse-transcribed into cDNA using the ReverTra Ace^Ò RT-qPCR Master Mix with gDNA remover (Toyobo, Cat No. FSQ-301), following the manufacturer's instruc­tions. Relative mRNA expression was quantified using the comparative method, with b-actin serving as the internal reference gene. Real-time PCR was performed using the SensiFAST SYBR^Ò No-ROX (Biolane, Cat No. BIO-98005) on a MiniOpticon instrument (Bio-Rad). Primer sequence used for Interleukin-6 (IL-6): Forward: CACTCACCTCTTCAGAACGAAT and Reverse: GCTGCTTTCACACATGTTACTC. As a house­keeping gene, β-actin was used, with primer sequen­ces: Forward: ACAGGATGCAGAAGGAGATTAC; Reverse: ATAGAGCCACCAATCCACAC. The data consisted of cycle threshold (CT) values auto­matically generated by the software. Relative mRNA expression levels were calculated using the Livak (2^DDCt) method [25].

Data analyses

Data are presented as the median and interquartile range (IQR). Differences between groups were tested using the Kruskal-Wallis test, followed by the Mann-Whitney U test. A p-value less than 0.05 was considered significant at the 95% confidence level. Because of the limited number of PBMCs used in this experiment, the analysis was considered preliminary. The experiment was conducted in three replicates and served as a technical control. All inferential statistics should be interpreted with caution and regarded as exploratory. Plots were created using GraphPad Prism version 10.1.1 (GraphPad Software, San Diego, CA, USA).

RESULTS AND DISCUSSION

Phytochemical profile and extraction yield

The ethanol extraction of 166.8 g of Phaleria macrocarpa fruit powder yielded 56.7 g of dried extract, corresponding to an extraction yield of 34%. Qualitative phytochemical screening (Table 1) indi­cated the presence of alkaloids, phenols, flavonoids, saponins, tannins, and triterpenoids. This broad phytochemical profile is consistent with the reported pharmacological potential of P. macrocarpa and supports its evaluation in anti-inflammatory assays in various conditions [26, 27, 28].

References in previous studies indicate that pha­lerin and mangiferin are the two main components and markers of Phaleria macrocarpa extracts [29, 30, 31]. Therefore, we conducted a targeted HPLC ana­lysis using the reference compounds phalerin and mangiferin. The results showed that the Phaleria macrocarpa fruit ethanol extract contained phalerin as the main compound at 3710 ng/mL (17.04%) and mangiferin, a bioactive compound with antidiabetic properties, at 82.17 ng/mL (2.93%). Studies have shown that Phaleria macrocarpa extracts rich in phalerin and mangiferin exert antidiabetic and anti-inflammatory activities [27, 30, 31, 32], thereby sub­stantiating their use in hyperinflammatory condi­tions aggravated by hyperglycemia.

Selection of a high-glucose culture condition

Glucose concentrations in culture supernatants were evaluated under the specified glucose conditions and are presented in Table 2. Among the four glucose-supplementation conditions tested, the 15 mM glucose-supplemented medium yielded a supernatant glucose concentration of 358 mg/dL, which cor­responds to the hyperglycemic range. When peripheral blood mononuclear cells were incubated for 24 hours under 15 mM glucose-supplemented condi­tions, IL-6 mRNA expression increased by about 1.80-fold compared with control (Fig. 2, a). Accordingly, 15 mM glucose was selected for subsequent expe­riments because it produced a measurable IL-6 mRNA response and represented exposure above the physiolo­gical reference of 5.5 mM.

Proinflammatory response to SARS-CoV-2 spike protein and lipopolysaccharides

In the present study, IL-6 mRNA expression was assessed as a marker of the acute proinflammatory response. Stimulation of PBMCs with the SARS-CoV-2 spike protein at 12.5 ng/mL for 24 hours resulted in about an 18-fold increase in IL-6 expres­sion compared with the control group (Fig. 2, b). Thus, the SARS-CoV-2 spike protein at 12.5 ng/mL was selected for sequential stimulation because it elicited the highest IL-6 response in this step.

Mechanistically, the SARS-CoV-2 spike protein activates proinflammatory signaling in immune cells. A study by Olajide et al. showed that high–dose SARS-CoV-2 S1 spike protein significantly increases secretion of TNF-α, IL-6, IL-1, and IL-8, along with upregulation of NF-κB signaling pathways [33]. Similar increases in IL-1 and IL-6 expression have been observed in PBMCs from patients with immune-mediated hearing loss (IMHL) stimulated with the SARS-CoV-2 spike protein at 12 ng/mL [34]. Prior ex vivo studies also indicate that the spike protein acts synergistically with low-dose LPS to enhance TNF- and IL-1 production [35]. Additionally, in silico studies have reported that the SARS-CoV-2 spike protein can bind not only to the angiotensin-converting enzyme 2 receptor but also to TLR4, a key receptor for lipopolysaccharide, potentially intensi­fying downstream inflammatory signaling [36]. However, receptor engagement and downstream pathway activation were not directly assessed in the present study; therefore, these mechanisms should be interpreted as literature-supported hypotheses rather than confirmed findings.

To induce a hyperinflammatory state, lipopoly­saccharide (LPS) was added to the culture medium to stimulate the innate immune response in PBMCs. LPS, a structural component of Gram-negative bacteria, a potent activator of the innate immune system and widely used in experimental models of inflammation because it mimics cytokine-mediated inflammatory responses. Upon interaction with innate immune cells, particularly monocytes and macro­phages, LPS stimulates the production of proinflam­matory cytokines and chemokines, thereby contri­buting to host defense mechanisms [37]. Toll-like receptor 4 (TLR4) is the primary receptor for LPS recognition and signal transduction. Binding of LPS to TLR4 activates NF-κB through recruitment and activation of MyD88, IL-1 receptor–associated ki­nase (IRAK), TNF receptor-associated factor 6 (TRAF6), and NADPH oxidase (Nox). NF-κB plays a central role in regulating the transcription of genes related to innate immunity and inflammatory responses [24].

Our results showed that PBMCs stimulated with LPS at 10 ng/mL had the greatest increase in IL-6 mRNA expression (Fig. 2, c). These findings align with previous studies showing that LPS stimulates the production of proinflammatory cytokines and chemo­kines in innate immune cells. Even low concen­trations of LPS have been shown to induce IL-6 and TNF-α production [37].

Activity of dexamethasone or Phaleria macro­carpa fruit extract on IL-6 expression in lipopo­lysaccharide-induced conditions

In the lipopolysaccharide-induced model (10 ng/mL), dexamethasone reduced IL-6 mRNA expression, with the greatest reduction at 50 ng/mL (Fig. 3, a). This effect is consistent with the known ability of glucocorticoids to suppress inflammatory gene transcription [38]. However, glucocorticoid re­ceptor signaling and nuclear factor-κB (NF-κB) acti­va­tion were not directly measured in this experiment.

Treatment with Phaleria macrocarpa fruit ex­tracts at several concentrations after LPS stimulation at 10 ng/mL generally reduced IL-6 mRNA expres­sion compared with the stimulated control (Fig. 3, b). However, the pattern was not entirely consistent. This variability may be attributable to the complex and heterogeneous chemical composition of herbal extracts, in which observed effects may result from the combined interactions of multiple constituents [39]. Therefore, these findings should be interpreted as a preliminary indication of an IL-6 mRNA-suppressive signal, suggesting that Phaleria macro­carpa fruit extract contains components that may attenuate LPS-induced IL-6 upregulation.

Cell viability assessment and determination of non-cytotoxic conditions

To confirm that changes in inflammatory markers were unaffected by the treatment's cytotoxic effects, cell viability was evaluated under the designated inflammatory stimulation and treatment conditions. The stimulatory agents (glucose, SARS-CoV-2 spike protein, and lipopolysaccharides) and the treatment agents (dexamethasone and Phaleria macrocarpa fruit extract) were assessed for their effects on PBMC viability. None of the treatments showed a significant reduction in cell viability compared with the control cells, and the average cell viability remained above 80% (Fig. 4).

The results suggest that the stimulation treatments used in subsequent analysis were unlikely to account for the observed effects on IL-6, indicating that these effects were unlikely to result from a significant loss of viable cells.

Suppression of IL-6 mRNA expression by Pha­leria macrocarpa extracts in the combined spike protein and lipopolysaccharide model under high-glucose conditions

Figure 5 addresses the central objective of estab­lishing an inflammatory model that incorporates both infection-associated stimuli and a high-glucose con­dition, and then applying it to the early screening of drug candidates.

Hyperglycemia is a common feature of poorly controlled diabetes, prompting investigation into how immune cells pre-exposed to elevated glucose levels respond to inflammatory stimuli. A previous study modeled this clinical context by pre-incubating PBMCs with graded glucose concentrations (5.5, 8, 16, and 24 mM) for 48 h, followed by stimulation with the TLR3 agonist poly(I: C) (20 µg/mL) for an additional 24 h. Hyperglycemia has been reported to increase proinflammatory cytokine production while impairing type I interferon generation and signaling, mechanisms that may exacerbate inflammatory res­ponses and weaken antimicrobial defenses in diabetes [40].

Additionally, hyperglycemia has been reported to predispose monocytes/macrophages to a proinflam­matory phenotype by increasing oxidative stress and enhancing NF-κB signaling, thereby intensifying responses to toll-like receptor 4 (TLR4) ligands, including lipopolysaccharide [40]. The combined use of high glucose, the SARS-CoV-2 spike protein, and lipopolysaccharide is therefore a biologically plausible experimental model of hyperglycemia, in which chronic metabolic stress may lower the threshold for cytokine production. However, the model should not be considered a full replication of diabetes-associated COVID-19 hyperinflammation.

Consistent with the above concept, increasing in vitro glucose concentrations from 5 to 25 mmol/L had only marginal effects on cytokine release after stimu­lation with M. tuberculosis lysate, LPS, or Candida albicans. In contrast, exposure to 40 mmol/L glucose markedly increased production of TNF-α, IL-1β, IL-6, and IL-10. Notably, IL-6 and IL-1β increased in a dose-dependent manner, whereas T-cell–derived cytokines showed greater variability. Collectively, these findings support the concept that substantial hyperglycemia can amplify inflammatory signaling in immune cells [41].

Stimulation with the SARS-CoV-2 spike protein in combination with LPS under high-glucose con­ditions resulted in elevated IL-6 expression compared with PBMCs maintained in control medium. These findings suggest that elevated glucose may enhance IL-6 mRNA responses to infectious or inflammatory stimuli in this experimental system. The observed response is consistent with the previous literature on spike protein-LPS interaction [42]. However, because nuclear factor kappa B (NF-kB), TLR4, MAPK, and related pathways were not directly measured, the mechanism cannot be confirmed by the present data. Treatment with the Phaleria macrocarpa fruit ethanol extract resulted in concentration-dependent suppression of IL-6 expression in the inflammatory PBMC model. This attenuation was comparable to that of dexamethasone, the positive control, thereby substantiating the preliminary data indicating that Phaleria macrocarpa fruit extract may inhibit IL-6 expression under the combined condition.

Taken together, these results (Fig. 5) demonstrate that the ethanol extract reduced IL-6 mRNA expres­sion induced by the SARS-CoV-2 spike protein and LPS under high-glucose conditions. This finding aligns with prior reports that P. macrocarpa contains bioactive constituents, such as alkaloids, flavonoids, phenolics, sterols, and terpenoids, which may inhibit IL-6 production and therefore possess potential anti-inflammatory activity relevant to inflammation associated with viral infections and hyperglycemia [43-46]. However, the present study did not identify which constituent was responsible for the observed effect and did not assess IL-6 at the protein level.

Our findings support the feasibility of a peripheral blood mononuclear cell inflammatory platform in­corporating high-glucose exposure. SARS-CoV-2 spike protein and lipopolysaccharide, when combined with high-glucose exposure, enhanced inflammatory responses. Additionally, initial evidence suggests that Phaleria macrocarpa fruit ethanol extract may re­duce IL-6 mRNA expression in this system. Dexa­methasone, used as a control, produced a similar suppression of IL-6 mRNA expression, consistent with its known anti-inflammatory pharmacology [38]. However, comparisons with dexamethasone should be interpreted with caution because only IL-6 mRNA expression was measured, and no protein-level or pathway-specific validation was performed. 

The present study remains an early-stage explo­ratory experiment because its primary endpoint is a single messenger of RNA marker. To improve mechanistic and translational relevance, subsequent studies should validate effects at the protein level, such as IL-6 concentrations in the supernatant; in­corporate additional inflammatory mediators, inclu­ding TNF-α, IL-1β, interferon responses, and oxida­tive stress markers; and improve the interpretability of extracts through analytical standardization and/or  fractionation.

The fruit of Phaleria macrocarpa contains phenolic and flavonoid compounds, including man­giferin and phalerin, that have been reported to influence inflammatory signaling and oxidative stress in preclinical studies [12, 29, 31]. The current study did not identify a single active constituent. Therefore, any proposed involvement of upstream pathways, such as NF-κB or mitogen-activated protein kinase cascades, remains hypothetical and should be tested directly in future work using pathway-specific assays [47]. Chemical standardization, such as high-per­formance liquid chromatography profiling, will be crucial for ensuring repeatability and facilitating future translation.

From a translational standpoint, the use of primary human immune cells offers advantages over immor­talized cell lines; however, inter-donor variability and limited biological replicates pose significant limi­tations. This study has several limitations. First, PBMCs were obtained from only two healthy female donors; therefore, donor-to-donor variability, sex-related immune differences, and generalizability could not be adequately assessed. Second, IL-6 mRNA expression was the sole inflammatory end­point, and no other inflammatory markers, such as TNF-α, IL-1β, or interferons, were measured. Finally, the findings are based on an in vitro model and should not be interpreted as evidence of clinical efficacy in COVID-19, diabetes, or diabetes-associated hyperin­flammation.  Subsequent research should involve a broader, more heterogeneous donor population, pro­tein-level multiplex cytokine assays, and an expanded endpoint panel and functional pathways.

CONCLUSIONS

1. This exploratory study established an in vitro inflammatory model using human peripheral blood mononuclear cells exposed to elevated glucose levels, subsequently stimulated with the Severe Acute Respiratory Syndrome Coronavirus-2 spike protein and lipopolysaccharides, with interleukin-6 mRNA expression as the primary marker of effect. 

2. Phaleria macrocarpa fruit ethanol extract reduced the interleukin-6 mRNA expression at non-cytotoxic concentrations under the tested conditions. Due to the limited number of PBMC donors, this data should be considered preliminary.

3. A subsequent study using a larger, sex-balanced donor population, broader anti-inflammatory end­points, and chemical standardization is needed before this cell-based platform can be applied to screen anti-inflammatory candidates under conditions of elevated glucose exposure.

Contributors:

Nurhasanah A.H. – data curation, formal analysis, writing original draft;

Louisa M. – conceptualization, methodology, su­pervision, review & editing;

Angelina M. – validation, supervision, review & editing;

Estuningtyas A. – validation, review & editing.

Funding. This research was funded by the Master Thesis Research Grant of the Ministry of Higher Education, Science and Technology, Re­public of Indo­nesia 2025 (Contract no. PKS-597/UN2/RST/HKP.05.00/2025) and Program Center of the Health Research Organization, Na­tional Research and Innovation Agency (Decision of the Head of The Health Research Organization, BRIN, No. 72/III.9/HK/2025).

Conflict of interests. The authors declare no conflict of interest.

REFERENCES

1. Carbajal J, Ballon‑Salcedo C, Uribe‑Cavero L, Saravia G, Cuadros‑Aguilar S, Lopez M, et al. Risk factors associated with the mortality of COVID‑19 in patients with type 2 diabetes mellitus. World Acad Sci J. 2024;6:62. doi: https://doi.org/10.3892/wasj.2024.277

2. Sharma P, Behl T, Sharma N, Singh S, Gre­wal AS, Albarrati A, et al. COVID-19 and diabetes: Asso­ciation intensify risk factors for morbidity and mortality. Biomed Pharmacother. 2022;151:113089. doi: https://doi.org/10.1016/j.biopha.2022.113089

3. Zhou Q, Zhang L, Dong Y, Wang Y, Zhang B, Zhou S, et al. The role of SARS-CoV-2-mediated NF-κB activation in COVID-19 patients. Hypertension Res. 2024;47:375-84. doi: https://doi.org/10.1038/s41440-023-01460-2  

4. Hiti L, Markovič T, Lainscak M, Farkaš Lain­ščak J, Pal E, Mlinarič-Raščan I. The immunopathogenesis of a cytokine storm: The key mechanisms underlying severe COVID-19. Cytokine Growth Factor Rev. 2025;82:1-17. doi: https://doi.org/10.1016/j.cytogfr.2024.12.003

5. Sharun K, Tiwari R, Dhama J, Dhama K. Dexa­methasone to combat cytokine storm in COVID-19: Clinical trials and preliminary evidence. Int J Surgery. 2020;82:179-81. doi: https://doi.org/10.1016/j.ijsu.2020.08.038 

6. Tuba S, Aprianto MR. Effectivity of Dexa­methasone Fighting Cytokine Storm in Severe COVID-19 Patients; Does it still reliable used for COVID-19? Formosa J Sci Tech. 2022;1:157-64. doi: https://doi.org/10.55927/fjst.v1i3.835

7. Landstra CP, de Koning EJP. COVID-19 and Diabetes: Understanding the Interrelationship and Risks for a Severe Course. Front Endocrinol (Lausanne). 2021 Jun 17;12:649525. doi: https://doi.org/10.3389/fendo.2021.649525

8. RECOVERY Collaborative Group. Dexa­metha­sone in Hospitalized Patients with COVID-19. New Engl J Med. 2021;384:693-704. doi: https://doi.org/10.1056/NEJMoa2021436

9. Arcani R, Cauchois R, Suchon P, Jean R, Jarrot P, Gomes De Pinho Q, et al. Factors associated with dexa­methasone efficacy in COVID‐19. A retrospective inves­tigative cohort study. J Med Virol. 2022;94:3169-75. doi: https://doi.org/10.1002/jmv.27712

10. Ghasemian M, Owlia S, Owlia MB. Review of Anti-Inflammatory Herbal Medicines. Adv Pharmacol Sci. 2016;2016:1-11. doi: https://doi.org/10.1155/2016/9130979

11. Gupta M, Singh N, Gulati M, Gupta R, Sudha­kar K, Kapoor B. Herbal bioactives in treatment of inflammation: An overview. South Afr J Botany. 2021;143:205-25. doi: https://doi.org/10.1016/j.sajb.2021.07.027

12. Hendra R, Ahmad S, Oskoueian E, Sukari A, Shu­kor MY. Antioxidant, Anti-inflammatory and Cyto­toxicity of Phaleria macrocarpa (Boerl.) Scheff Fruit. BMC Complement Altern Med. 2011;11:110. doi: https://doi.org/10.1186/1472-6882-11-110

13. Ahmad R, Khairul Nizam Mazlan M, Firdaus Abdul Aziz A, Mohd Gazzali A, Amir Rawa MS, Wahab HA. Phaleria macrocarpa (Scheff.) Boerl.: An updated review of pharmacological effects, toxicity studies, and separation techniques. Saudi Pharm J. 2023;31:874-88. doi: https://doi.org/10.1016/j.jsps.2023.04.006

14. Lestari I, Lindarto D, Ilyas S, Widyawati T, Mus­tofa M, Jusuf N, et al. Effect of Phaleria Macrocarpa (Scheff.) Boerl Leaf Ethanol Extract on Serum IL-6 and TNF-α Levels in Diabetic Rats. Med Archiv. 2023;77:254. doi: https://doi.org/10.5455/medarh.2023.77.254-257

15. Heriatmo NL, Estuningtyas A, Soetikno V, Poer­waningsih EH, Kusmardi K. Attenuation of TNF-α and Iron Levels in Renal Hemosiderosis by Phaleria macrocarpa (Scheff.) Boerl Extract in a Rat Iron Overload Model. Indones J Pharm. 2024;35(3):481-90. doi: https://doi.org/10.22146/ijp.6811

16. Petruk G, Puthia M, Petrlova J, Samsudin F, Strömdahl A-C, Cerps S, et al. SARS-CoV-2 spike protein binds to bacterial lipopolysaccharide and boosts proin­flammatory activity. J Mol Cell Biol. 2021;12:916-32. doi: https://doi.org/10.1093/jmcb/mjaa067

17. Hansur L, Louisa M, Ernawaty B, Wuyung PE, Zaini J, Fadillah F, et al. Histopathology assay of the lung after intratracheal injection of SARS-CoV-2 spike protein recombinant in mice: A preliminary study. AIP Conf Proc. 2024;3080:090002. doi: https://doi.org/10.1063/5.0199399

18. Hansur L, Louisa M, Wuyung PE, Fadilah F. Daphnoretin from Carthamus tinctorius as a Potential Inflammatory Inhibitor in COVID-19 by Binding to Toll-like Receptor-4: An in silico Molecular Docking Study. Open Access Maced J Med Sci. 2022;10:220-7. doi: https://doi.org/10.3889/oamjms.2022.7961

19. Melgaço JG, Azamor T, Silva AMV, Linha­res JHR, dos Santos TP, Mendes YS, et al. Two-Step In Vitro Model to Evaluate the Cellular Immune Response to SARS-CoV-2. Cells. 2021;10:2206. doi: https://doi.org/10.3390/cells10092206

20. Nichols JH, Smith AM, Jonsson CB. The Inter­section of SARS-CoV-2 and Diabetes. Microorganisms. 2025;13:1390. doi: https://doi.org/10.3390/microorganisms13061390

21. Abubakar AR, Haque M. Preparation of medicinal plants: Basic extraction and fractionation procedures for experimental purposes. J Pharm Bioallied Sci. 2020;12:1-10. doi: https://doi.org/10.4103/jpbs.JPBS_175_19

22. Rizki M, Harahap U, Sitorus P. Phytochemical Screening Of Phaleria Macrocarpa (Scheff.) Boerl.) And Antibacterial Activity Test Of Ethanol Extract Against Staphylococcus Aureus Bacteria. Int J Sci Tech Mana­gement. 2023;4:422-7. doi: https://doi.org/10.46729/ijstm.v4i2.781

23. Čolić M, Bekić M, Tomić S, Đokić J, Ra­doje­vić D, Šavikin K, et al. Immunomodulatory Properties of Pomegranate Peel Extract in a Model of Human Peripheral Blood Mononuclear Cell Culture. Phar­maceutics. 2022;14:1140. doi: https://doi.org/10.3390/pharmaceutics14061140

24. Ngkelo A, Meja K, Yeadon M, Adcock I, Kir­kham PA. LPS induced inflammatory responses in human peripheral blood mononuclear cells is mediated through NOX4 and G iα dependent PI-3kinase signalling. J Inflamm. 2012 Jan 12;9(1):1. doi: https://doi.org/10.1186/1476-9255-9-1

25. Livak K, Schmittgen T. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402-8. doi: https://doi.org/10.1006/meth.2001.1262

26. Agustin E, Insanu M, Mauludin R. Improvement in Pharmacological Activity of Mahkota Dewa (Phaleria macrocarpa (Schef. Boerl)) Seed Extracts in Nanoemulsion Dosage Form: In vitro and In vivo Studies. Pharm Nanotechnol. 2024;12:90-7. doi: https://doi.org/10.2174/2211738511666230602100045

27. Shofiah A, Christina YI, Dwijayanti DR, Soe­wondo A, Widodo N, Djati MS. Exploring the inflam_matory pathway modulation of Phaleria macrocarpa: evidence from in vitro and in silico studies. Pharmacia. 2025;72:1-14. doi: https://doi.org/10.3897/pharmacia.72.e153095

28. Rizki M, Harahap U, Sitorus P. Phytochemical Screening of Phaleria macrocarpa (Scheff.) Boerl.) and Antibacterial Activity Test of Ethanol Extract Against Staphylococcus aureus Bacteria. Int J Sci Technol Management. 2023;4:422-7. doi: https://doi.org/10.46729/ijstm.v4i2.781

29. Oshimi S, Zaima K, Matsuno Y, Hirasawa Y, Iizu­ka T, Studiawan H, et al. Studies on the constituents from the fruits of Phaleria macrocarpa. J Nat Med. 2008;62:207-10. doi: https://doi.org/10.1007/s11418-007-0209-9

30. Ali RB, Atangwho IJ, Kaur N, Abraika OS, Ah­mad M, Mahmud R, et al. Bioassay-Guided Antidiabetic Study of Phaleria macrocarpa Fruit Extract. Molecules. 2012;17:4986-5002. doi: https://doi.org/10.3390/molecules17054986

31. Altaf R, Asmawi M Bin, Dewa A, Sadikun A, Umar M. Phytochemistry and medicinal properties of Pha­leria macrocarpa (Scheff.) Boerl. extracts. Pharmacogn Rev. 2013;7:73. doi: https://doi.org/10.4103/0973-7847.112853

32. Lestari IC, Ghufron M, Herwiyanti S, Ari Su­miwi YA. The effects of ethanolic extract of Phaleria macrocarpa (Scheff.) Boerl leaf on macrophage phagocytic activity in diabetic rat model. J Med Sci. 2018;50:140-9. doi: https://doi.org/10.19106/JMedSci005002201802

33. Olajide OA, Iwuanyanwu VU, Lepiarz‐Raba I, Al‐Hindawi AA, Aderogba MA, Sharp HL, et al. Garcinia kola and garcinoic acid suppress SARS‐CoV‐2 spike glycoprotein S1‐induced hyper‐inflammation in human PBMCs through inhibition of NF‐κB activation. Phytother Res. 2021;35:6963-73. doi: https://doi.org/10.1002/ptr.7315

34. Pathak S, Tan N, Vambutas A. A pilot study on the effect of SARS-CoV-2 spike protein on IL-1β-mediated inflammation in peripheral blood immune cells from AIED patients. Mol Med. 2025;31:174. doi: https://doi.org/10.1186/s10020-025-01227-0

35. Tumpara S, Gründing AR, Sivaraman K, Wren­ger S, Olejnicka B, Welte T, et al. Boosted Pro-Inflam­matory Activity in Human PBMCs by Lipopolysaccharide and SARS-CoV-2 Spike Protein Is Regulated by α-1 Antitrypsin. Int J Mol Sci. 2021;22:7941. doi: https://doi.org/10.3390/ijms22157941

36. Bhattacharya M, Sharma AR, Mallick B, Shar­ma G, Lee S-S, Chakraborty C. Immunoinformatics ap­proach to understand molecular interaction between multi-epitopic regions of SARS-CoV-2 spike-protein with TLR4/MD-2 complex. Infect Genet Evol. 2020;85:104587. doi: https://doi.org/10.1016/j.meegid.2020.104587

37. Chaiwut R, Kasinrerk W. Very low concentration of lipopolysaccharide can induce the production of various cytokines and chemokines in human primary monocytes. BMC Res Notes. 2022 Feb 10;15(1):42. doi: https://doi.org/10.1186/s13104-022-05941-4

38. Świerczek A, Jusko WJ. Pharmacokinetic/Phar­macodynamic Modeling of Dexamethasone Anti-Inflam­matory and Immunomodulatory Effects in LPS-Chal­lenged Rats: A Model for Cytokine Release Syndromes. J Pharmacol Exp Ther. 2023;384:455-72. doi: https://doi.org/10.1124/jpet.122.001477

39. Kiyomi A, Matsuda A, Nara M, Yamazaki K, Imai S, Sugiura M. Immunological Differences in Human Pe­ripheral Blood Mononuclear Cells Treated with Tradi­tional Japanese Herbal Medicines Hochuekkito, Juzen­taihoto, and Ninjin’yoeito from Different Pharmaceutical Companies. Evidence-Based Compl Altern Med. 2021;2021:7605057. doi: https://doi.org/10.1155/2021/7605057

40. Hu R, Xia CQ, Butfiloski E, Clare-Salzler M. Effect of high glucose on cytokine production by human peripheral blood immune cells and type I interferon signaling in monocytes: Implications for the role of hyperglycemia in the diabetes inflammatory process and host defense against infection. Clin Immunol. 2018;195:139-48. doi: https://doi.org/10.1016/j.clim.2018.06.003

41. Lachmandas E, Vrieling F, Wilson LG, Joos­ten SA, Netea MG, Ottenhoff TH, et al. The effect of hyperglycaemia on in vitro cytokine production and macrophage infection with mycobacterium tuberculosis. PloS One. 2015 Feb 9;10(2):e0117941. doi: https://doi.org/10.1371/journal.pone.0117941

42. Petruk G, Puthia M, Petrlova J, Samsudin F, Strömdahl AC, Cerps S, et al. SARS-CoV-2 spike protein binds to bacterial lipopolysaccharide and boosts pro­inflammatory activity. J Mol Cell Biol. 2020;12:916-32. doi: https://doi.org/10.1093/jmcb/mjaa067

43. Ahmad R, Khairul Nizam Mazlan M, Firdaus Abdul Aziz A, Mohd Gazzali A, Amir Rawa MS, Wahab HA. Phaleria macrocarpa (Scheff.) Boerl.: An updated review of pharmacological effects, toxicity studies, and separation techniques. Saudi Pharm J. 2023;31:874-88. doi: https://doi.org/10.1016/j.jsps.2023.04.006

44. Lestari IC, Ghufron M, Herwiyanti S, Ari Sumi­wi YA. The effects of ethanolic extract of Phaleria mac­rocarpa (Scheff.) Boerl leaf on macrophage phagocytic activity in diabetic rat model. J Med Sci. 2018;50:140-9. doi: https://doi.org/10.19106/jmedsci005002201802

45. Kusmardi K, Situmorang NY, Zuraidah E, Estu­ningtyas A, Tedjo A. The effect of mahkota dewa (Phaleria macrocarpa) leaf extract on the Mucin 1 expression in mice colonic epithelial cells induced by dextran sodium sulfate (DSS). Pharmacogn J. 2021;13:1509-15. doi: https://doi.org/10.5530/pj.2021.13.192

46. Ali R, Atangwho I, Kaur N, Abraika O. Bioassay-Guided Antidiabetic Study of Phaleria macrocarpa Fruit Extract. Molecules. 2012;17:4986-5002. doi: https://doi.org/10.3390/molecules17054986

47. Millrine D, Jenkins RH, Hughes STO, Jones SA. Making sense of IL‐6 signalling cues in pathophysiology. FEBS Lett. 2022;596:567-88. doi: https://doi.org/10.1002/1873-3468.14201

Деталі

Перегляди: 221

Key words: squamous cell carcinoma, oropharynx, budding, grading, prognosis, immunohistochemistry, Ki-67, p16

Ключові слова: плоскоклітинний рак, ротоглотка, брунькування, градації, прогноз, імуногістохімія, Кі-67, р16

Abstract

The World Health Organization report on the prevalence of oropharyngeal cancer (OC) places it in sixth place among men and tenth among women worldwide. A pressing problem is the increase in OC cases in recent decades among young patients, which researchers associate infection with  high-risk human papillomavirus (HPV). Among all OC, many histological forms are squamous cell carcinomas (SCC). It should be noted that HPV-associated carcinomas have a better prognosis, namely up to 20% of patients do not show recurrence after treatment, which is significantly different from the course observed in patients with HPV-unassociated OC. In the context of cancer prognosis, another important prognostic indicator is interesting - tumor budding (TB), which actively develops on the side of the invasive front of the tumor and is often described in literature as an independent factor of poor prognosis, early vascular invasion and metastasis. There are very few studies comparing the intensity of TB and HPV association for the prognosis of SCC and they mostly concern tumors of other areas of the head and neck, which determines the relevance of this work.The aim of the work is to investigate the distribution of tumor budding gradations according to clinical and morphological characteristics of oropharyngeal squamous cell carcinomas important for prognosis, in particular, to assess the relationship of budding with HPV association (p16 status) and proliferation index (Ki-67 expression).For the study, biopsy and surgical material samples of SCC of the oropharynx of 69 patients (21 women and 48 men) who were in the oncology department of the Dnipropetrovsk Regional Clinical Hospital named after I.I. Mechnikov, Dnipro from 2019 to 2022 and received appropriate treatment were selected. The age of the patients ranged from 45 to 86 years; the average age was 64.09±8.95 years. IHC was performed according to the TermoScientific (TS) protocols with primary antibodies p16 (sp1, RTU, LabVision, USA) and Ki-67 (sp6, RTU, LabVision, USA), and the Lab Vision Quanto (TS, USA) imaging system.The distribution of TB grades according to the three-level system (from 0 to 4 cells - 1 (low), from 5 to 9 clusters – 2 (moderate), from 10 and more – 3 (high) according to clinical and morphological indicators showed a statistically significant difference only by the sex of the patients, namely the gradation of high budding levels among men was significantly higher than among women (10 out of 11 (90.91%) compared to 1 out of 11 (9.09%)), (p<0.05), this is probably due to the prevalence of such bad habits among men as smoking and alcohol abuse, which are frequent etiological causes of head and neck cancer development, as an alternative path to the development of OC without HPV infection.Distribution of TB grades in HPV-positive samples (p16 – positive) and HPV-negative (p16-negative) OC demonstrated the largest number of HPV-negative carcinomas in the subgroup with 3 budding grades, namely with grade 1 HPV-negative (p16-negative) were 59.38% of samples (19 out of 32), with grade 2 – 57.69% of samples (15 out of 26), and with grade 3 – already 90.91% of samples (10 out of 11), (p<0.05), which confirms the more unfavorable prognosis of HPV-unassociated OC.The proliferation index by Ki-67 did not show a statistically significant relationship with the distribution of TB grades, which makes the latter an independent factor in the prognosis in SCC of the oropharynx.

Реферат

Визначення градацій брунькування в плоскоклітинних раках ротоглотки. Пославська О.В., Дідовець Д.Ю., Рахманов В.В., Чекан С.М., Алєксєєнко О.А. Звіт ВООЗ про поширеність раку ротоглотки (РР) ставить його на шосту позицію серед чоловіків і десяту серед жінок у всьому світі. Актуальною проблемою є зростання кількості випадків РР за останні десятиліття серед молодих пацієнтів, що дослідники пов’язують з інфікуванням вірусом папіломи людини (ВПЛ) високого онкогенного ризику. Серед усіх РР більшість гісто­логічних форм припадає на плоскоклітинні раки (ПР). Треба зазначити, що асоційовані з ВПЛ-інфекцією карциноми мають кращий прогноз, а саме до 20% пацієнтів не демонструють рецидивів після лікування, що значно відрізняється від перебігу, який спостерігається в пацієнтів з ВПЛ-неасоційованими РР. У контексті прогнозу онкозахворювань цікавим є ще один важливий прогностичний показник – пухлинне брунькування (ПБ), що активно розвивається на боці інвазивного фронту пухлини й часто описане в літературі як незалежний фактор поганого прогнозу, ранньої судинної інвазії та метастазування. Досліджень зіставлення інтенсивності ПБ та ВПЛ-асоціації для прогнозу перебігу ПР вкрай мало і вони здебільшого стосуються пухлин інших ділянок голови та шиї, що й обумовлює актуальність цієї роботи. Мета роботи – дослідити розподіл градацій пухлинного брунькування за важливими для прогнозу клінічними та морфологічними характеристиками плоско­клітинних раків ротоглотки, зокрема оцінити зв’язок брунькування з ВПЛ-асоціацією (р16-статусом) та індексом проліферації (експресії Кі-67). Для дослідження були вибрані зразки біопсійного та операційного ма­теріалу ПР ротоглотки 69 пацієнтів (21 жінки і 48 чоловіків), що перебували в ЛОР-онкологічному відділенні КП «Дніпропетровська обласна клінічна лікарня ім. І.І. Мечникова» ДОР м. Дніпра в період з 2019 до 2022 р. та отримали відповідне лікування. Вік пацієнтів коливався в діапазоні 45-86 років, середній вік становив 64,09±8,95 року. ІГХ проводили за протоколами TermoScientific (TS) з первинними антитілами p16 (sp1, RTU, LabVision, США) та Ki-67 (sp6, RTU, LabVision, США), й системою візуалізації Lab Vision Quanto (TS, США). Розподіл градацій ПБ за трирівневою системою (від 0 до 4 клітин – 1 (низька), від 5 до 9 кластерів – 2 (помірна), від 10 і більше – 3 (висока) за клініко-морфологічними показниками показав статистично достовірну різницю тільки за статтю пацієнтів, а саме: градація високого рівня ПБ серед чоловіків виявилась значно більшою, ніж серед жінок (10 з 11 (90,91%) порівняно з 1 з 11 (9,09%)), (p<0,05), вірогідно це пов’язано з поширенням серед чоловіків таких поганих звичок, як паління та зловживання алкоголем, що є частими етіологічними причинами розвитку раків голови й шиї, як альтернативний шлях розвитку РР без ВПЛ-інфекції. Розподіл градацій ПБ у зразках ВПЛ-позитивних (р16 – позитивних) та ВПЛ-негативних (р16 – негативних) РР продемонстрував найбільшу кількість ВПЛ-негативних карцином у підгрупі з 3 градацією брунькування, а саме: з градацією 1 ВПЛ-негативними (р16-негативними) були 59,38% зразків (19 з 32), з градацією 2 – 57,69% зразків (15 з 26), і з 3 градацією – уже 90,91% зразків (10 з 11), (p<0,05), що підтверджує більш несприятливий прогноз ВПЛ-неасоційованих РР. Індекс проліферації за Кі-67 не показав статистично достовірного зв’язку з розподілом градацій ПБ, що робить його незалежним фактором прогнозу ПР ротоглотки.

Before the emergence of COVID-19, malignant tumors ranked second among the causes of death worldwide [20]. In total, in 2022, almost 20 million cases of cancer were detected in the world, with almost half of them being fatal. About 100 thousand of the recorded cases were localized in the oro­pharyngeal area [3]. In 2024 in Ukraine more than a million cancer patients were registered, almost 10 thousand with pharyngeal lesions [7]. Statistical data make it possible to understand that cancer, including oropharyngeal squamous cell carcinomas (SCC), is a significant problem that leads to many deaths annually and requires further research.

SCC, or epidermoid carcinoma, is one of several types of malignant tumors that originate from squa­mous epithelial cells. SCC of the head and neck includes the oral cavity, oropharynx, and larynx, and is the most common malignancy arising in this area. The main risk factors are smoking, alcohol con­sumption, and high-risk human papillomavirus (HPV) [6, 8, 15]. The WHO classification of head and neck tumors, fifth revision, makes a clear distinction between HPV-associated and HPV-non-associated SCCs. The existence of separate terminology for these two tumor types em­phasizes the difference in their carcinogenesis based on the potential for involvement of transcriptionally active high-risk HPVs (HPV16, HPV18, etc.) [13]. HPV E7 protein inactivation of pRb leads to over-expression of p16^INK4a, making it a surrogate marker for HPV. Simi­larly, HPV E6 protein can inactivate p53 and a lower frequency of p53 mutations is observed in HPV-positive tumors. The p16 marker detects expression of the protein 16^INK4a, which is a cyclin-dependent kinase inhibitor and inhibits cell cycle progression at the G1 checkpoint without en­tering S. Loss of p16 expression due to HPV exposure (deletion, mutation or hyper­methylation) is a pathway for the develop­ment of SCC and can be used for diagnosis if polyme­rase chain reaction is too ex­pensive or not available [30].

In the context of cancer prognosis, another important prognostic indicator is interesting – TB, which actively develops on the side of the invasive front of the tumor and is often described in the literature as an independent factor of poor prognosis, early vascular invasion and metastasis. The proli­feration index is a very important indicator for determining the activity of the expansion of the invasive front of the tumor. Tumor budding is most actively manifested precisely at the invasive front, so these indicators should be interconnected. The proli­feration index can be obtained by counting the nuclei stained with the Ki-67 marker by immunohisto­chemical method. This indicator has long become the gold standard in the study of many malignant tumors.

There are very few studies comparing the intensity of TB and HPV association for the pro­gnosis of SCC and they mostly concern tumors of other areas of the head and neck, which determines the relevance of this work.

Aim of the work. To study the distribution of tumor budding gradations according to clinical and morphological characteristics of oropharyngeal squa­mous cell carcinomas important for prognosis, in particular, to assess the relationship of budding with HPV association (p16 status) and proliferation index (Ki-67 expression).

MATERIALS AND METHODS OF RESEARCH

For the study, biopsy and surgical samples of SCC of the oropharynx of 69 patients (21 women and 48 men) who were in the oncology department of the Dnipropetrovsk Regional Clinical Hospital named after I.I. Mechnikov, Dnipro, Ukraine, in the period from 2019 to 2022 and received appropriate treatment were selected. The age of the patients ranged from 45-86 years; the average age was 64.09±8.95 years. All se­lected cases were repre­sen­ted by squamous cell car­cinomas with keratinization 32 (46.38%) and without kerati­niza­tion 37 (53.62%). Clinical data on patients with SCC of the oropharynx also included information on the pre­sence of metastases and re­lapses (the distri­bu­tion of pa­tients according to clini­cal data is given in Table 1).

All patients were included in the study after providing their informed written consent. The study was conducted in accordance with the written consent of the participants and in accordance with the principles of bioethics set out in the Declaration of Helsinki "Ethical Principles of Medical Research Involving Humans" [28], the "Universal Declaration on Bioethics and Human Rights (UNESCO)" and national guidelines on bioethical principles of scientific research (excerpt from the protocol of the Biomedical Ethics Committee of Dnipro State Medi­cal University, No. 9 dated October 26, 2021).

Ready-made histological preparations (paraffin sections 4-5 μm thick on glass slides, stained with hematoxylin and eosin) and blocks (fixed in formalin and paraffin-embedded tissues) of selected cases of SCCO for a thorough histological study were taken from the archive of the Dnipro Regional Pathological Anatomical Bureau, Dnipro, Ukraine. When asses­sing changes in the oropharyngeal mucosa, the internal control (conditional norm) was taken as a multilayered squamous epithelium that fell into the section next to the squamous cell carcinoma at the edges of the resection. Light microscopy in trans­mitted light was performed with a ZEISS "Primo Star" microscope with a Zeiss Primo Star – Axiocam ERC 5s camera (licensed ZEN 2 blue edition soft­ware for obtaining microphotographs) [27].

To obtain new sections of SCCO, adhesive Super Frost Plus slides were used for IHC. Then, deparaf­finization, rehydration, temperature unmasking of antigens, inhibition of endogenous peroxidase acti­vity, and incubation of sections with primary antibodies in humid chambers at a temperature of 23-25°C for 30 minutes were performed [17]. Primary monoclonal antibodies to the p16 oncoprotein (sp1, RTU, Lab Vision, USA) were used to detect HPV in SCCO samples, and the Ki-67 marker (sp6, RTU, Lab Vision, USA) was used to calculate the proliferation index. The Ultra Vision Quanto imaging system and the DAB chromogen (brown) were selected accor­ding to the manufacturer's protocols [17].

Evaluation of immunohistochemical staining. Ac­cording to the recommendations of the authors de Fer­reira C. et al. (2021) [5], the reaction with the p16 mar­ker in SCCO tumor cells was considered positive for HPV if it demonstrated strong diffuse nuclear-cyto­plasmic staining in more than 75% of the cells (Fig. 1).

According to the recommendations of the authors Yadav P. et al. (2019) [30], the calculation of the proliferation index in SCCO samples was carried out by the expression of the Ki-67 marker as the percentage of stained cells per 1000 tumor cells in the ×400 microscope field: according to the gradations 0 (<10% of stained cells), 1 (10%-50%) and 2 (>50%). Gradations 1 and 2 were considered a positive reac­tion, 0 – a negative reaction (Fig. 2).

Statistical analysis of data was performed in the R software environment version 3.4.1 (2017-06-30) – "Single Candle" Copyright (C) 2017; The R Foun­dation for Statistical Computing Platform: x86_64-w64-mingw32/x64 (64-bit), which is freely distri­buted under the GNU General Public License. The signifi­cance of the difference in the study groups ac­cording to the quantitative distribution of samp­les  was determi­ned by Fisher's exact test due to small  samples. The difference was considered significant at p<0.05 [24].

Results and discussion

All observations of SCCO were divided into three groups according to the gradations of TB, according to the general recommendations used for SCC of the head and neck, namely: if there are from 0 to 4 single cells or clusters of up to 5 cells, the TB gradation was consi­dered 1 (low), from 5 to 9 clusters – 2 (mode­rate), from 10 and more – 3 (high gradation) (Fig. 3). To identify the relationship between clinical and morphological indicators of PRRG and the calculated grades of tumor budding, the number of cases was listed in Table 2.

It should be noted that both among men and women, the distribution between low and moderate gradations of TB was almost equal (20 out of 48, and 18 out of 48 for men, and 12 out of 21, and 8 out of 21 for women), but the gradation of high budding level among male patients significantly prevailed over that of female patients (10 out of 11 (90.91%) compared to 1 out of 11 (9.09%), which according to Fisher's exact test showed a sta­tistically significant difference in distribution (p<0.05).

 Low level of TB was most often found in the age groups from 50 to 59 years and from 60 to 69 years (12 out of 32, 37.50% and 10 out of 32, 31.25%, respec­ti­vely). Moderate level in the age group from 60 to 69 years (13 out of 26, 50.00%), and high in the age group from 70 to 79 years (6 out of 11, 54.55%), but no statistically significant difference was found (p>0.05).

Fig. 3. A. Absence of budding in SCCO samples (gradation 1), H-E staining, (×400). B. TB grade 1 - low (from 0 to 4 single cells or clusters up to 5 cells, yellow arrows), H-E staining, (×400). C. TB grade 2 (from 5 to 9 clusters, yellow arrows), H-E staining, (×400). D. TB grade 3 (from 10 or more single cells or clusters up to 5 cells, yellow arrows), H-E staining, (×400) ↓

High and moderate levels of TB were divided almost equally between forms with and without ke­ratinization (moderate level – 13 out of 26, 50% with keratinization and 13 out of 26, 50% without keratini­zation; high level – 6 out of 11, 54.55% with kerati­ni­zation and 5 out of 11, 45.45% without keratiniza­tion). For low level there was some difference between forms with and without keratinization (13 out of 32, 40.63% for samples with keratinization and 19 out of 32, 59.37% for samples without it without it), (p>0.05).

Almost equally there were divided the grades of TB in samples with and without metastases (low level – 17 out of 32, 53.13% without metastases and 15 out of 32, 46.87% with metastases; moderate level – 12 out of 26, 46.15% without metastases and 14 out of 26, 53.85% with metastases; high level – 5 out of 11, 45.45% without metastases and 6 out of 11, 54.55% without metastases), no statistically signi­ficant difference was found (p>0.05).

Among all three gradations of TB, cases without relapses occurred equally more often than cases with them (29 out of 32, 90.62% without relapses for low level, 25 out of 26, 96.15% for moderate and 10 out of 11, 90.91% for high), therefore, no statistically significant difference was found (p>0.05).

The next stage of our study was the calculation of the proliferation index in the areas of the invasive front and the division into gradations. The calculation of the proliferation index is most conveniently performed by IHC using nuclear expression of the Ki-67 marker, which is the gold standard for diagnosing cell division for tumors of different localizations. To identify the relationship between HPV status and proliferative activity of SCCO and calculated bud­ding grades, the number of cases with different ex­pres­sion of p16 and Ki-67 markers was listed in Table 3.

Distribution of TB grades was shifted towards HPV-negative cases (for low-level HPV-negative ca­ses were 19 out of 32 samples, 59.38%, for mode­rate TB – 15 out of 26, 57.69%, for high TB – 10 out of 11, 90.91%, respectively), which was reflected in a statistically significant difference between these sub­groups (p<0.05). Unlike p16 expression, the Ki-67 marker demonstrated a more even distribution: among all three gradations of TB, cases with grade 1 Ki-67 expression occurred equally more often than with grade 2 (25 out of 32, 78.13% for low TB, 18 out of 26, 69.23% for moderate TB, and 9 out of 11, 81.82% for high TB) and therefore no statistically significant dif­ference was found between these subgroups (p>0.05).

TB was first described in 1954 by the Japanese scientist Imai T., but it began to be used as a pro­gnostic criterion only at the beginning of the 21st century. TB is a histological indicator characterized by the presence of single tumor cells or small clusters (up to 5 cells) scattered in the stroma at various distances from the invasive growth front of a ma­lignant tumor [2; 14; 22]. TB is an important marker of an aggressive course of a malignant tumor with loss of intercellular contacts and a high probability of vascular invasion, which should be used to assess the prognosis of cancer. In many studies, the level of TB was associated with a worse prognosis for patients [4, 10, 12, 18, 26]. This is especially relevant for colo­rectal carcinomas, where this indicator is included in the WHO recommendations as mandatory when assessing the aggressiveness of cancers of this localization after numerous studies have confirmed the importance of TB in large cohorts of patients [13]. Studies of the TB process in head and neck tumors are less common, and mostly concern the oral cavity, but they also show the significance of this indicator for prognosis [1, 9, 11, 16, 19, 21-23, 25]. For example, in the study of Narayanan A. V. et al. (2025) it was determined that the level of TB is an important indi­cator, along with the degree of tumor differentiation and metastasis to the lymph nodes of the head and neck, which can be used to predict the development of SCC of the oral cavity [14].

However, there are very few studies of TB grades for SCCO in general, and none in Ukraine at all, despite the large number of cases of morbidity and mortality from SCCO. In addition, there is no precise instruction for the use of TB grades for SCCO in the practice of pathologists, because the fact of using TB as a histological criterion for the prognosis of the course of SCCO in this location is poorly studied.

Information on the TB grades for head and neck cancers is found in individual publications as subjective recommendations of individual scientists. For example, Claudio Cacchi et al. (2024) suggest using the TB grades as follows: if there are 0 to 4 single cells or clusters of up to 5 cells, the TB level is 1 (low), from 5 to 9 clusters the level is 2 (mo­derate), 10 or more clusters the level is 3 (high) [2]. At the same time, Shreshtha Ghosh and Priyadarshini Guha (2023) propose a TB grade with a division only into high and low levels, where low is less than 5 buds, and high is 5 or more cells [21].

For oral cancers, the TB grades are mostly similar to the option from the study by Claudio Cacchi et al. (2024), namely in the studies of Anand Vijaya Na­rayanan et al. (2025), or Nan Xie et al. (2016) used the budding gradations as follows: if there are from 0 to 4 single cells or clusters of up to 5 cells, the level of TB is 1 (low), from 5 to 9 clusters the level is 2 (moderate), 10 or more clusters the level is 3 (high) [2; 14; 26]. But for SCCO such information was not found.

In this work, for the first time for our region, the distribution of TB gradations of SCCO was analyzed with regard to sex, age, histological form, regional lymph node involvement and relapses after treatment. For the first time, an analysis of the relationship between HPV status and proliferative activity of SCCO according to TB grades was performed to determine the significance of the latter in the pro­gnosis of tumors this localization.

CONCLUSION

1. The distribution of tumor budding grades accor­ding to the three-level system (from 0 to 4 cells – 1 (low), from 5 to 9 clusters – 2 (moderate), from 10 and more – 3 (high) according to clinical and morpho­logical indicators showed a statistically significant difference only by the sex of the patients, namely the gradation of high budding levels among men was significantly higher than among women (10 out of 11 (90.91%) compared to 1 out of 11 (9.09%), (p<0.05), this is probably due to the prevalence of such bad habits among men as smoking and alcohol abuse, which are frequent etiological causes of head and neck cancer development, as an alternative path to the development of oropharyngeal cancer without human papillomavirus infection.

2. The distribution of tumor budding grades in human papillomavirus-positive samples (p16-posi­tive) and human papillomavirus-negative (p16-nega­tive) oropharyngeal cancer demonstrated the largest number of human papillomavirus-negative carcino­mas in the subgroup with 3 budding grades, namely with grade 1 human papillomavirus-negative (p16-negative) were 59.38% of samples (19 out of 32), with grade 2 – 57.69% of samples (15 out of 26), and with grade 3 – already 90.91% of samples (10 out of 11), (p<0.05), which confirms the more unfavorable pro­gnosis of HPV-unassociated oropharyngeal cancer.

3. The Ki-67 proliferation index did not show a statistically significant relationship with the distri­bution oftumor budding grades, which makes the latter an independent factor in the prognosis ofs quamous cell carcinoma of the oropharynx.

Prospects for further research. Continuation of studying tumor budding process in squamous cell carcinoma of other locations is promising and has not yet been studied enough to identify additional prognostic criteria.

Contributors:

Poslavska O.V. – conceptualization, methodolo­gy, formal analysis;

Didovets D.Y. – investigation, resources, wri­ting – original draft;

Rakhmanov V.V. – data curation, validation;

Chekan S.M. – writing – review & editing, super­vision;

Alekseenko O.A. – project administration, fun­ding acquisition.

Funding. This research received no external funding.

Conflict of interests. The authors declare no conflict of interest.

REFERENCES

1. Barman S, Ahuja S, Kumar R, Zaheer S. Progno­stic significance of tumor budding in head and neck squamous cell carcinoma: association with clinico­patho­logical features. Surgical and Experimental Pathology. 2025;8(7):1-6.
doi: https://doi.org/10.1186/s42047-025-00181-9

2. Cacchi C, Fischer HJ, Wermker K, Rashad A, Jonigk DD, Hölzle F, et al. New Tumor Budding Eva­luation in Head and Neck Squamous Cell Carcinomas. Cancers (Basel). 2024 Jan30;16(3):587. doi: https://doi.org/10.3390/cancers16030587 

3. Cancer Today. Global Cancer Observatory [Inter­net]. 2025 [cited 2025 Sep 11]. Available from: https://gco.iarc.who.int/today/en   

4. Chu J, Kim HS, DO SI. Clinicopathological Sig­ni­ficance and Predictive Value of High Intratumoral Tumor Bud­ding in Patients With Breast Carcinoma Treated With Ne­oadjuvant Chemotherapy. Anticancer Res. 2023;43(5):2323-32. doi: https://doi.org/10.21873/anticanres.16397

5. de Ferreira C, Dufloth R, de Carvalho AC, Reis RM, Santana I, Carvalho RS, et al. Correlation of p16 immunohistochemistry with clinical and epidemiological features in oropharyngeal squamous-cell carcinoma. PLoS One. 2021;16(6):e0253418. doi: https://doi.org/10.1371/journal.pone.0253418

6. Ebrahimi E, Sangphukieo A, Park HA, Gabo­rieau V, Ferreiro-Iglesias A, Diergaarde B, et al. Cross-ancestral GWAS identifies 29 variants across head and neck cancer subsites. Nat Commun. 2025;16(1):8787. doi: https://doi.org/10.1038/s41467-025-63842-z  

7. Fedorenko Z, Gorokh Y, Ryzhov A, Soumkina O. Can­cer in Ukraine, 2023 – 2024. Incidence, mortality, preva­lence and other relevant statistics. Bulletin of the National Cancer Registry of Ukraine. 2025;26:62. Available from: http://www.ncru.inf.ua/publications/BULL_26/index_e.htm

8. Johnson DE, Burtness B, Leemans CR, Lui VWY, Bauman JE, Grandis JR. Head and neck squamous cell carcinoma. Nat Rev Dis Primers. 2020 Nov 26;6(1):92. doi: https://doi.org/10.1038/s41572-020-00224-3

9. Kale AD, Angadi PV. Tumor budding is a po­tential histopathological marker in the prognosis of oral squamous cell carcinoma: Current status and future prospects. J Oral Maxillofac Pathol. 2019;23(3):318-23. doi: https://doi.org/10.4103/jomfp.JOMFP_331_19

10. Kawachi H, Eishi Y, Ueno H, Nemoto T, Fujimo­ri T, Iwashita A, et al. A three-tier classification system based on the depth of submucosal invasion and bud­ding/sprouting can improve the treatment strategy for T1 colorectal cancer: a retrospective multicenter study. Mod Pathol. 2015;28(6):872-9. doi: https://doi.org/10.1038/modpathol.2015.36  

11. Lugli A, Zlobec I, Berger MD, Kirsch R, Nag­tegaal ID. Tumour budding in solid cancers. Nat Rev Clin Oncol. 2021;18(2):101-15. doi: https://doi.org/10.1038/s41571-020-0422-y

12. Masuda R, Kijima H, Imamura N, Aruga N, Naka­mura Y, Masuda D, et al. Tumor budding is a significant indicator of a poor prognosis in lung squamous cell carcinoma patients. Mol Med Rep. 2012;6(5):937-43. doi: https://doi.org/10.3892/mmr.2012.1048

13. Nagtegaal ID, Odze RD, Klimstra D, Paradis V, Rugge M, Schirmacher P, et al. The 2019 WHO classi­fication of tumours of the digestive system. Histo­pathology. 2020 Jan;76(2):182-8. doi: https://doi.org/10.1111/his.13975

14. Narayanan AV, Umashankar K, Aravind S, Naya­nar SK, Vijay S. Tumor Budding as an Independent Prognostic Histopathological Marker in Oral Squamous Cell Carcinoma – An Indian Tertiary Care Center Experience. Turk Patoloji Derg. 2025;41(2):31-41. doi: https://doi.org/10.5146/tjpath.2025.13761

15. National cancer institute. Dictionary of Cancer Terms. Squamous cell carcinoma [Internet]. 2025 [cited 2025 Nov 11]. Available from:  https://www.cancer.gov/publications/dictionaries/cancer-terms/def/squamous-cell-carcinoma-of-the-head-and-neck

16. Niranjan KC, Raj M, Hallikeri K. Prognostic evaluation of tumour budding in oral squamous cell carcinoma: Evidenced by CD44 expression as a cancer stem cell marker. Pathol Res Pract. 2023;251:154883. doi: https://doi.org/10.1016/j.prp.2023.154883

17. Nguyen T. Immunohistochemistry: A Technical Guide to Current Practices. Cambridge: Cambridge University Press; 2022.

18. Okcu O, Şen B, Aşkan G, Öztürk Ç, Öztürk SD, Bedir R. Tumor Budding is an Independent Prognostic Factor to Predict Overall Survival in Endometrial Endometrioid Carcinoma: A Retrospective Study. Int J Surg Pathol. 2023;31(1):26-37. doi: https://doi.org/10.1177/10668969221116541   

19. Omae T, Omori Y, Makihara Y, Yamanegi K, Hanawa S, Yoshikawa K, et al. Mechanism of Tumor Budding in Patient-Derived Metachronous Oral Primary Squamous Cell Carcinoma Cell Lines. Int J Mol Sci. 2025;26(7):3347. doi: https://doi.org/10.3390/ijms26073347  

20. Our World in Data. Causes of death, World [Internet]. 2019 [cited 2025 Sep 13]. Available from: https://www.cancer.gov/publications/dictionaries/cancer-terms/def/squamous-cell-carcinoma-of-the-head-and-neck

21. Shreshtha Ghosh, Priyadarshini Guha. Evaluation of Tumour Budding in Head and Neck Squamous Cell Carcinoma and Its Relationship with other Histological Parameters of Prognosis. Asian Pacific Journal of Cancer Biology. 2023;8(3):203-9. doi: https://doi.org/10.31557/apjcb.2023.8.3.203-209

22. Silva FFVE, Caponio VCA, Pérez-Sayáns M, Pa­dín-Iruegas ME, Mascitti M, Chamorro-Petronacci CM, et al. Tumor budding is a prognostic factor in head and neck squamous cell carcinoma: A comprehensive meta-analysis and trial sequential analysis. Crit Rev Oncol Hematol. 2024;193:104202. doi: https://doi.org/10.1016/j.critrevonc.2023.104202

23. Stögbauer F, Beck S, Ourailidis I, Hess J, Po­remba C, Lauterbach M, et al. Tumour budding-based gra­ding as independent prognostic biomarker in HPV-positive and HPV-negative head and neck cancer. Br J Cancer. 2023;128(12):2295-306. doi: https://doi.org/10.1038/s41416-023-02240-y 

24. Strakhova OP, Androsov OI. [Statistical methods of processing the results of medical and biological research: educational and methodological manual]. Lviv: Vydavets Marchenko T.V.; 2021. Ukrainian.

25. Togni L, Caponio VCA, Zerman N, Troiano G, Zhurakivska K, Lo Muzio L, et al. The Emerging Impact of Tumor Budding in Oral Squamous Cell Carcinoma: Main Issues and Clinical Relevance of a New Prognostic Marker. Cancers (Basel). 2022;14(15):3571. doi: https://doi.org/10.3390/cancers14153571  

26. Unal B, Celik MY, Gedik EO, Bassorgun CI, El­pek GO. Tumor budding as a potential prognostic marker in determining the behavior of primary liver cancers. World J Hepatol. 2023;15(6):775-85. doi: https://doi.org/10.4254/wjh.v15.i6.775

27. Vareniuk IM, Dzerzhynskyi ME. [Methods of cyto-histological diagnosis]. Kyiv: Interservis; 2019 [cited 2025 Sep 13]. Ukrainian. Available from: https://biomed.knu.ua/institute-activity/educational/­kafedry/kafedra-cytology/library-cytology/3046-metodi-tsito-gistologichnoji-diagnostiki-navchalnij-posibnik.html

28. World Medical Association. World Medical Association Declaration of Helsinki: ethical principles for medical research involving human subjects. JAMA. 2013 Nov 27;310(20):2191-4. doi: https://doi.org/10.1001/jama.2013.281053

29. Xie N, Yu P, Liu H, Liu X, Hou J, Chen X, et al. Validation of the International Tumor Budding Con­sensus Conference (2016) recommendations in oral tongue squamous cell carcinoma. J Oral Pathol Med. 2019;48(6):451-8. doi: https://doi.org/10.1111/jop.12856

30. Yadav P, Malik R, Balani S, Nigam RK, Jain P, Tan­don P. Expression of p-16, Ki-67 and p-53 markers in dys­plastic and malignant lesions of the oral cavity and oro­pharynx. J Oral Maxillofac Pathol. 2019 May-Aug;23(2):224-30. doi: https://doi.org/10.4103/jomfp.JOMFP_299_18

Деталі

Перегляди: 184

Ключові слова: хвороба Маделунга, доброякісний симетричний ліпоматоз, діагностика, лікування, клінічний випадок

Key words: Madelung’s disease, benign symmetrical lipomatosis, diagnostics, treatment, clinical case

Реферат

Хвороба Маделунга (ХМ) (доброякісний симетричний ліпоматоз) – рідкісне захворювання невідомої етіології, що проявляється симетричними аномальними відкладеннями жирової тканини на голові, шиї та верхній частині тулуба. Мета – ознайомити спеціалістів-практиків з проблемою діагностики та лікування рідкісного захворювання жирової тканини – ХМ, надати приклад власного клінічного спостереження. Ми повідомляємо про випадок ХМ у 73-річної жінки, у якої прогресуюче накопичення жирової тканини спричинило сильну інспіраторну задишку, як атиповий симптом, та ураження шийно-грудного відділу хребта. Обговорюються етіопатогенетичні, клініко-діагностичні, хірургічні та терапевтичні аспекти лікування цього рідкісного захворювання. Діагноз ХМ повинен ґрунтуватися на фізичному огляді та клінічних ознаках, доповнених даними ультразвукового, радіологічного дослідження (комп’ютерна томографія, магнітно-резонансна томографія), відповідних ділянок та зіставлятися з патоморфологічним діагнозом у складних випадках. Через прогресуюче збільшення розмірів жирової тканини ХМ має не лише естетичні, але й функціональні, а іноді й небезпечні для життя наслідки, які потребують лікування. Встановлення діагнозу вимагає диференціальної діагностики з іншими захворюваннями, які супроводжуються надлишком жирової тканини. Особливої уваги вимагає настороженість щодо можливої малігнізації ліпоми.

Abstract

Madelung's disease is a rare disease of adipose tissue. Rodionova V.V., Yatsuba O.O., Dmytrychenko V.V., Kovalenko O.Yu. Madelung’s disease (MD) (benign symmetrical lipomatosis) is a rare disease of unknown etiology, manifested by symmetrical abnormal deposits of adipose tissue on the head, neck and upper torso. The aim is to familiarize practitioners with the problem of diagnosis and treatment of a rare disease of adipose tissue – MD, and to provide an example of our own clinical observation. We report a case of MD in a 73-year-old woman in whom progressive accumulation of adipose tissue caused severe inspiratory dyspnea as an atypical symptom and damage to the cervico-thoracic spine. The etiopathogenetic, clinical-diagnostic, surgical and therapeutic aspects of the treatment of this rare disease are discussed. The diagnosis of MD should be based on physical examination and clinical signs, supplemented by ultrasound, radiological examination (computed tomography, magnetic resonance imaging), relevant areas and compared with the pathomorphological diagnosis in complex cases. Due to the progressive increase in the size of adipose tissue, MD has not only aesthetic, but also functional, and sometimes life-threatening consequences that require treatment. Establishing the diagnosis requires differential diagnosis with other diseases that are accompanied by excess adipose tissue. Special attention requires vigilance in terms of possible malignancy of lipoma.

Доброякісний множинний ліпоматоз, дифузна ліпома шиї, дифузний симетричний ліпоматоз, головогрудна ліподистрофія, синдром Лонуа-Бансода (за французькими лікарями Р.Е. Launois, 1856-1914; R. Bensaude, 1866-1938) – численні назви захворювання, яке увійшло в наукову медичну літературу як хвороба Маделунга (ХМ). Уперше захворювання було описано в 1846 році Бенджаміном Броді, який назвав його «синдро­мом жирної шиї». У 1888 році Отто фон Маделунг повідомив про серію з 33 пацієнтів з ліпомами, виникнення яких він пов’язував з хронічним алкоголізмом, а вже наступного року Лануа та Бансо оприлюднили дані 65 пацієнтів з по­дібними ознаками ліпом [1]. Досить цікавим фактом є те, що хоча свою офіційну назву захворювання дістало в 1888 р. після повідом­лення Отто фон Маделунга, однак, за даними Noushif Medappil [2], ще раніше подібний фенотип був зображений на різьблених зобра­женнях цариці Пунта (поблизу Єгипту), яка померла майже 34 століття тому (рис. 1, наведено за Camillo O. Di Cicco, 2005) [3].

У 1970 році Greene M.L. et al. повідомили, що серед європейців було виявлено 150 випадків захворювання [4]. На сьогодні приблизний під­рахунок описаних у літературі випадків ХМ ста­новить близько 400, що досі не дає змоги достовірного встановлення механізму розвитку цієї досить рідкісної патології [5].

Мета дослідження – ознайомити спеціалістів-практиків з проблемою діагностики та лікування рідкісного захворювання жирової тканини – хвороби Маделунга (доброякісного множинного ліпоматозу), надати приклад власного клінічного спостереження.

Дослідження проведено відповідно до прин­ципів біоетики, викладених у Гельсінській декла­рації «Етичні принципи медичних досліджень за участю людей» та «Загальній декларації про біоетику та права людини (ЮНЕСКО)» (протокол № 21 від 18.09. 2024 р.) та біомедичної етики Дніпровського державного медичного універси­тету (протокол № 36 від 11.03.2026 р.). Пацієнтка надала згоду на оприлюднення особистих даних та фотографій.

Актуальність проблеми зумовлена рідкістю зустрічальності та нез’ясованими досі етіологіч­ними аспектами ХМ. Більшість авторів повідом­ляє, що основною причиною ХМ є тривале вживання алкоголю. Захворювання частіше зустрічається в Середземномор’ї, у літературі було опубліковано понад 200 випадків, з яких 90% пацієнтів мали в анамнезі алкоголізм. Але захворювання також було зафіксовано в не­алкоголіків та жінок [6, 7, 8]. Захворювання спос­терігається переважно в дорослих чоловіків у віковій групі 30-60 років. Співвідношення пацієн­тів чоловічої та жіночої статі становить 15:1-30:1. В огляді, який включав 286 пацієнтів з ХМ, Liu Q. et al. зазначили, що 89,5% пацієнтів тривало зловживали алкоголем та в 53% ви­падків були курцями в анамнезі [9]. Хоча причинно-наслід­ковий зв’язок між алкоголем та ХМ залишається незрозумілим, Mevio E. et al. відзначили зв’язок з хронічним алкоголізмом у 69-90% пацієнтів [10].

Достеменно патогенез ХМ досі не з’ясований, її виникнення пов’язують з дисфункцією мітохон­дрій жирової тканини, відкладенням жиру, індукованим катехоламінами, зниженням актив­ності цитохромоксидази та зниженням активності індукованої синтази оксиду азоту [11]. У новіших патофізіологічних дослідженнях спостерігалися порушення ліпідного обміну на мітохондріаль­ному рівні, що виявило численні патологічні субсарколемальні скупчення мітохондрій у попе­реково-смугастих м’язових волокнах у пацієнтів з ХМ. Крім того, Southern blott-тести виявили численні делеції мітохондріальної ДНК [12]. З’ясовано, що тривале вживання алкоголю при­зводить до мутацій мітохондріальної ДНК, її передчасного окиснення та, зрештою, до дис­функції мітохондріальних клітин [13]. Також були повідомлення про мутації в генах LIPE, LMNA, CAPSL та MFN2, які пов’язані з енер­гетичним дисбалансом та накопиченням дис­функціональних мітохондрій [14, 15, 16, 17]. Крім того, хронічне споживання алкоголю може при­звести до зниження активності та кількості бета-адренергічних рецепторів, а отже, і до синтезу тріацилгліцеролів [18]. Крім того, етанол під­вищує активність цитохрому P450 у жировій тканині, що зрештою призводить до апоптозу та запалення жирової тканини [19].

Досить цікавим вважається припущення про генетичну схильність до розвитку захворювання. Переважний тип успадкування – автосомно-домінантний. При цьому носій дефектного гена страждає на патологію сам і передає її половині своїх нащадків. Хлопчики та дівчатка хворіють однаково часто. Описані родинні випадки ХМ, зумовлені мутаціями мітохондріальної ДНК, за яких захворювання передається жіночою лінією дітям обох статей. Описані випадки виявлення па­тології в дітей і жінок, які не вживають алкоголь, але число цих випадків мізерно мале [1].

Разом із хронічним вживанням алкоголю роз­глядають наявність таких факторів, як гіперури­кемія, гіперліпідемія, цукровий діабет, захворю­ван­ня печінки, гіпотиреоз, нирковий тубулярний аци­доз [9, 20]. Парадоксально, але при ХМ концентра­ція холестерину ліпопротеїдів високої щільності (ЛПВЩ) у сироватці крові зазвичай висока [11, 21].

Можливим здається порушення нейротрофіч­них впливів на жирову тканину, ураження нерво­вої системи внаслідок травми чи інтоксикації призводить до порушення балансу гормонів залоз внутрішньої секреції та позначається на обміні ліпідів в організмі несприятливим чином.

Дослідження показали, що уражена тканина при ХМ не являє собою гіпертрофію вже існуючої жирової тканини, а радше проліферацію жирових клітин [5]. Цей факт був підтверджений Ko­dish M.E. et al., які продемонстрували, що різні стимуляційні та навантажувальні тести із сомато­тропним гормоном, кортизолом, інсуліном або глюкагоном призводять до пригнічення вивіль­нення вільних жирних кислот з ліпоматозної тканини у відповідь на фізіологічні стимули [23]. Вони виявили, що це відбувається, незважаючи на нормальний рівень ліполітичних гормонів, і може бути пов’язано з функціональною денервацією ураженої жирової тканини. Припускають, що функціональна симпатична денервація при­зво­дить до гіпертрофії бурого жиру [23], особливо враховуючи, що розподіл і тип адипоцитів при ХМ подібні до бурої жирової тканини [13]. Однак, з гістологічної точки зору, відкладення жирової тканини не відрізняються від зрілого жиру, за винятком різного ступеня фіброзу та, рідко, кальцифікації [24]. Крім того, головні адипоцити в пацієнтів з ХМ менші за розміром, і спосте­рігається підвищений вміст судинної та фіброзної тканин порівняно з нормальним рівнем [25].

Іноді ХМ вважають захворюванням шийних лімфовузлів з наслідком аденоліпозу. Ураження лімфатичних вузлів відбувається з поступовим заміщенням лімфоїдної тканини на жирову. Однак аденоліпоз зачіпає переважно поверхнево розташовані лімфовузли та розвивається си­метрично по обидва боки тіла [26].

Незважаючи на існування численних гіпотез, точна етіологія та патофізіологічні шляхи, що призводять до розвитку захворювання, зали­шаються неясними [27]. Всі ці фактори не є доведеними як остаточні детермінанти. Алкоголь, на думку ряду дослідників, стає тим «пусковим» фактором, який дозволяє реалізуватися генетич­ної схильності, що є в пацієнта [1, 28].

Існують повноцінні описання клінічної карти­ни цієї патології. Нещодавно ХМ була визнана у двох клінічних фенотипах. Тип 1 уражає пере­важно чоловіків і характеризується накопиченням жирової тканини навколо шиї, потилиці, верхньої частини спини, плечей. Тип 2 уражає як чоловіків, так і жінок, призводячи до перебільшеного роз­поділу жирової тканини в жінок у верхній частині спини, дельтоподібній ділянці, плечах, стегнах та верхній частині стегон [1].

ХМ характеризується появою множинних, безболісних утворень, розподілених по всьому тілу, які є дифузними та симетричними. Через дуже складну анатомічну структуру щелепно-лицевої ділянки ділянки шиї та обличчя ура­жаються найбільше, і в цих випадках рівень захворю­ваності високий [29]. У літературі по­відомляється, що при виникненні утворення на шиї в пацієнтів можуть розвиватися такі симп­томи, як обмежене обертання шиї, здавлення ди­хальних шляхів або дисфагія (рис. 2, приведено за даними [1]). Якщо жирова тканина проникає в привушну залозу, у пацієнтів можуть розвиватися деформації обличчя. Інвазія дна ротової порож­нини може обмежувати рухи язика та спричиняти дисфагію. Крім того, інвазія язика може при­звести до розвитку «мегаязика» [30].

Пацієнти зазвичай звертаються зі скаргами на косметичні проблеми, хоча вони також можуть відчувати труднощі з ковтанням та поворотом голови, а також скаржаться на біль у шиї або симптоми, пов’язані з органами середостіння [31]. Деякі пацієнти стикаються з ризиками, що загрожують життю, такими як трахеобронхіальна обструкція, дисфагія, дисфонія, медіастинальний синдром або вегетативна нейропатія [32-35].

При обстеженні в більшості пацієнтів за­звичай виявляються захворювання печінки, такі як цироз або жирові дегенеративні зміни [9]. Водночас дані комп’ютерної томографії (КТ) та магнітно-резонансної томографії (МРТ), пов’я­зані з обстеженням уражених ділянок при ХМ, не були добре описані.

Деякі автори вважають, що діагноз ХМ ґрунтується на (I) клінічних проявах, (II) візуа­лізаційному дослідженні КТ, МРТ або допплеро­графії та (III) тривалому анамнезі вживання алкоголю пацієнтом [14, 36], інші вважають гісто­логічне дослідження важливим у первинній діагностиці захворювання [25].

Доплерівське ультразвукове дослідження наразі є діагностичним інструментом першої лінії для ХМ [37] та виявляє нерівності й дифузне потовщення підшкірної жирової тканини без наявності капсул [38].

КТ-дослідження виявляє скупчення множин­них підшкірних утворень, чітко окреслених та низької щільності, які стискають або навіть деформують сусідні структури [39], підшкірних шарах, тоді як класичні ліпоми виглядають як м’які тканинні маси з високою інтенсивністю сигналу та низькою інтенсивністю сигналу фіброзними перегородками. Завдяки чудовій роздільній здатності контрастування м’яких тканин МРТ-дослідження є діагностичним стан­дартом [40], дозволяючи оцінити площини розмежування між ліпомою, м’язами та судинами [41], що особливо важливо у випадках розташу­вання на шиї та щелепно-лицевій ділянці. Вико­ристання контрастної речовини має вирішальне значення при підозрі на саркоматозну дегене­рацію, оскільки воно краще оцінює як краї пухлини, так і нерегулярну васкуляризацію [42]. Також МРТ-дослідження цінне не лише для оцінювання змін жирової тканини та розташо­ваних поряд органів і тканин, але й для під­твердження відсутності підозрілих ознак злоякіс­ності, можливості перед­операційного планування [19].

Диференціальна діагностика ХМ включає інші подібні стани, такі як ліпоматоз, ангіоліпома, ліподистрофія, ліпосаркома, гіперкортицизм, дифузне збільшення щитоподібної залози, за­хворювання слинних залоз, синдром Фреліха, хвороба Деркума, нейрофіброми та синдром Кушинга [43, 44, 45]. Завжди важливо пам’ятати про можливість спонтанної трансформації жиро­вого утворення в ліпосаркому [46, 47]. Так, є повідомлення про виникнення раку голови та шиї, зокрема плоскоклітинного раку гіпофаринкса, у пацієнтів з ХМ [48]. Tiziane et al. описали виникнення інтраміксоїдної саркоми після шести років спостереження [46], тоді як інші автори задокументували кілька рідкісних випадків транс­формації в ліпосаркому [47, 49]. Однак, врахо­вуючи поширені канцерогенні фактори ризику (алкоголь та куріння), саме ці фактори, більш імовірно, відповідають за розвиток пухлин.

Метою лікування при ХМ є зменшення пору­шення функції м’язів та покращення фізичного вигляду пацієнтів [17]. Варіанти лікування ХМ включають ліпектомію, ліпосакцію або локальне введення ліків задля ліполізу [50, 51, 52]. Серед них перші два є основними класичними варіан­тами лікування ХМ, хоча їхня ефективність залишається невизначеною, оскільки ліпоми неінкапсульовані, тому ліпектомія або ліпосакція не можуть досягти повного видалення, рецидив після хірургічного лікування ліпом є поширеним явищем [50]. Liu Q. et al. повідомили у своєму огляді, що ліпектомія була найпоширенішим методом лікування (69,5%, n=308), наступними були ліпосакція (24,2%) та комбінація ліпосакції та ліпектомії (6,1%). У тому ж дослідженні рівень рецидивів був подібним як для ліпектомії, так і для ліпосакції, із середнім часом рецидиву 6,3 року (від 7 місяців до 10 років) [9]. Крім того, рецидив найчастіше спостерігався в ділянці шиї, ймовірно, через труднощі з повним видаленням жирових відкладень у цій ділянці. Зазвичай вибір хірургічного методу повинен ураховувати тяж­кість захворювання (об’єм відкладень), розташу­вання пухлинних мас, очікування пацієнта та досвід хірурга. Однак більшість хірургів [53, 54] віддають перевагу відкритій ліпектомії, за допо­могою якої жирові грудки можна безпечно видалити під безпосереднім спостереженням, тим самим захищаючи тканинні структури та запобігаючи надмірній кровотечі [55]. Оскільки жирові відкладення неінкапсульовані та дифузно інфільтрують м’язи та судини без чіткої площини дисекції, деякі автори вважають відкриту операцію обов’язковою в певних анатомічних ділянках [56]. Ліпосакція зазвичай показана для ліпом, розташованих у грудній, черевній або кінцівковій ділянках, і рідко використовується для ліпом у шийному відділі [57].

У випадку великих пухлинних мас хірургічне втручання є найефективнішим методом лікуван­ня, оскільки воно зменшує симптоми компресії, покращує локальну дисфункцію та відновлює фізичний вигляд, тим самим покращуючи якість життя пацієнта [38]. Крім того, ліпектомія дозволяє точно ідентифікувати та безпосередньо візуалізувати життєво важливі структури, а також здійснити ефективний гемостаз [53]. У таких випадках розсічення жирових мас зазвичай вико­нується одним хірургічним втручанням. Однак через широкий спектр уражень, що спосте­рігаються в цих пацієнтів, деякі автори рекомен­дують метод поетапної резекції, щоб уникнути посилення кровотечі під час операції [58].

Щодо підшкірного введення ліполітичних розчинів (мезотерапія), таких як лецитин або фосфатидилхолін, ці методи лікування можуть мати певні позитивні результати. Однак наявний найбільш тривожний побічний ефект, такий як розвиток нейропатії, перешкоджає регулярному використанню цієї методики [59, 60].

Усім пацієнтам також рекомендується припи­нити вживання алкоголю, оскільки дослідження показали, що утримання від алкоголю може уповільнити збільшення жирових утворень та зменшити ризик рецидиву [19].

МАТЕРІАЛИ ТА МЕТОДИ ДОСЛІДЖЕНЬ

Клінічний випадок.

Хвора К, 1952 р.н., була направлена на кон­сультацію у зв’язку зі скаргами на задишку, біль у шийному відділі хребта, неможливість ви­конання рухів у шийному відділі хребта, виник­нення пухлиноподібних утворень, що зростають у потиличній ділянці та у верхній частині спини, м’язову слабкість, погіршення самосприйняття.

З’ясовано, що ці утворення з’явилися при­близно 5 років потому. Їхнє виникнення змусило звернутися за медичною допомогою до лікаря-дерматолога, у зв’язку із порушенням естетич­ного вигляду. Пацієнтці було запропоновано використання дієти з обмеженням жирів та вуглеводів, застосування лікувальної фізичної гімнастики, спрямованої на збільшення об’єму рухів у шийному відділі хребта та верхньому плечовому поясі. Оскільки змін у стані пацієнтки не відбулося, було надано направлення на консультацію до лікаря-хірурга, який запропо­нував проведення ліпосакції на задній поверхні шиї. Пацієнтка від проведення операції від­мовилася через побоювання ускладнень. Через певний час пацієнтка помітила подальше зрос­тання утворень на задній поверхні шиї, масивне розростання у верхній частині спини. В останні місяці приєднався постійний тягнучий біль у ділянці пухлин на шиї, біль у шийному та грудному відділі хребта, з’явились задишка, м’язова слабкість у руках.

З анамнезу з’ясовано, що хвора протягом життя вживала лише слабоалкогольні напої в обмеженій кількості (не більше 50-70 мл) 1-2 рази на місяць або рідше, ніхто в родині пацієнтки не мав ознак ХМ або будь-яких ліпом. У 2005 р. перенесла операцію – холецистектомію. Рік потому при обстеженні виявлено підвищення рівня глюкози в крові, встановлений діагноз цукрового діабету ІІ типу, лікується метфор­міном. Страждає на гіпертонічну хворобу ІІ ст., 3 ст., гіпертензивне серце, серцеву недостатність стадії С зі збереженою фракцією викиду (62%), хронічну серцеву недостатність ІІ-А стадії, ІІІ функціональний клас за NYHA.

Дані при обстеженні: статури нормостенічної, загальне ожиріння (індекс маси тіла – 38,6 кг/м²), колір шкіри звичайний, слизові оболонки блідо-рожеві. Незначна осиплість голосу. Лімфатичні вузли не пальпуються. На задньобоковій поверхні шиї є м’яко-еластичне утворення (ліпома) без чітких меж, щільна жирова клітковина інтимно підпаяна до м’язів шиї. Ліпома поширюється до середини спини. На обох плечах по внутрішній поверхні – симетричні ліпоми. По передній по­верхні верхньої третини обох передпліч – ана­логічні утворення. Шкіра над ліпомами не змінена (рис. 3). Молочні залози без особли­востей. При аускультації в легенях дихання везикулярне, рівномірно послаблене. Проведення перкусії грудної клітки неможливе через великий об’єм ліпоми. Частота дихання 18 за 1 хв. Межі серцевої тупості розширені вліво на 1,5 см від середньоключичної лінії. Тони серця при аус­куль­тації глухі, ритм правильний. Артеріальний тиск 180/100-150/95 мм рт. ст., частота серцевих скоро­чень (ЧСС) 78-82 за 1 хв. Живіт м’який, без­боліс­ний при пальпації. Печінка пальпується біля краю реберної дуги, селезінка не пальпується. Перифе­ричних набряків на нижніх кінцівках немає. Фізіологічні відправлення без особливостей.

Незначна деформація променево-зап’ясткових суглобів. Після рентгенологічного дообстеження суглобів установлений діагноз двостороннього арт­розу суглобів зап’ястя та променево-зап’яст­кових суглобів (різке нерівномірне звуження суглобових щілин, субхондральний остеосклероз, крайові остеофіти променево-зап’ясткових суглобів).

Хворій проведено лабораторне обстеження. Загальний аналіз крові (2024 р.): гемоглобін (Hb) – 141 г/л; еритроцити (Ер.) – 4,73 Т/л; лейко­цити (Л.) – 7,39 Г/л; сегментоядерні нейтрофіли (С/яд. нейт.) – 60%, лімфоцити (Лімф.) – 33%, моноцити (Мон.) – 7%, швидкість осідання ери­троцитів (ШОЕ) – 3 мм/год.

Загальний аналіз крові (2025 р.): Hb – 144 г/л; Eр. – 4,62 Г/л; Л. – 6,30 Г/л; С/яд. нейт. – 74%, Лімф. – 20%, Мон. – 6%, ШОЕ – 2 мм/год.

Біохімічний аналіз крові (2024 р.): креатинін – 86 мкмоль/л (референтні значення (реф. знач.) 44-80); сечова кислота – 438 мкмоль/л (реф. знач. 150-350), азот сечовини – 2,3 ммоль/л (реф. знач. 2,1-7,1), глюкоза – 4,25 ммоль/л (реф. знач. 4,0-5,5); білок загальний – 67,8 г/л (реф. знач. 60-85); біліру­бін загальний – 13,6 мкмоль/л (реф. знач. 5,0 до 20,5), аспартатамінотрансфераза (АСТ) – 31 Од/л (реф. знач. <32), аланінамінотрансфераза (АЛТ) – 33 Од/л (реф. знач. <33), загальний хо­лестерин – 4,03 ммоль/л (реф. знач. 5,0-5,2), β-ліпо­протеїди (β-ЛП) – 56.1 у.о. (реф. знач. 35-55 умов­них од.), ліпопротеїди високої щільності (ЛПВЩ) – 1,00 ммоль/л (реф. знач. 1,2-1,4), ліпо­про­теїди низької щільності (ЛПНЩ) – 2,15 ммоль/л (реф. знач. 3,3-4,8), коефіцієнт атеро­генності – 3,03 (реф. знач. <5,0), глюкоза крові 4,7 ммоль/л, глікований гемоглобін – 5,9% (реф. знач. 4-5,7).

Біохімічний аналіз крові (2025 р.): креатинін – 98 мкмоль/л; сечовина – 5,8 ммоль/л (реф. знач. 2,5-8,3), азот сечовини – 2,7 ммоль/л, загальний білок – 68 г/л; білірубін загальний – 1,4 ммоль/л, АСТ – 50 Од/л, АЛТ – 42 Од/л, загальний холес­терин – 4,58 ммоль/л, β-ЛП – 54,6 у.о., тригліце­риди – 1,77 ммоль/л (реф. знач. <1,7), ЛПВЩ – 0,92 ммоль/л, ЛПНЩ – 0,8 ммоль/л, коефіцієнт атерогенності – 3,98.

Індекс HOMA – 10,33 (реф. знач. 2,5-2,7), інсулін – 23,98 мкМОд/мл (реф. знач. 2,6 до 24,9), глюкоза крові – 9,69 ммоль/л, тиреотропний гор­мон – 2,84 мкМОд/мл (реф. знач. 0,4-4,0), адрено­кортикотропний гормон – 11,24 пг/мл (реф. знач. 0-46), глікований гемоглобін – 6,68%, 25-гідро­ксикальциферол (25-OH-D) – 22,69 (реф. знач. 20-30) нг/мл, кортизол слини: 12,41 нг/мл (реф. знач. 3,0-10,0), кальцій іонізований – 1,13 ммоль/л (реф. знач. 1,15-1,33), калій – 4,50 (реф. знач. 3,5-5,1) ммоль/л, натрій – 138,0 (реф. знач. 136,0-145,0) ммоль/л, хлор – 101,0 (реф. знач. 98,0-107,0) ммоль/л.

Коагулограма (2024 р.): протромбіновий індекс (ПтІ) – 88% (реф. знач. 80-110), протромбіновий час (ПтЧ) – 17 сек. (реф. знач. 11-13,5), фібриноген (ФГ) – 3,96 г/л (реф. знач. 2-4).

Коагулограма (2025 р.): ПтІ – 88%, ПтЧ – 17 сек., ФГ – 5,5 г/л.

Показники загального аналізу сечі в межах референтних значень.

Електрокардіограма (2024, 2025 рр.): елек­трична вісь серця відхилена вліво. Ритм сину­совий, правильний. ЧСС 72 удари за хв. Ознаки гіпертрофії лівого шлуночка.

Ультразвукове дослідження (УЗД) органів че­ревної порожнини (2025 р.): виявлені помірні дифузні зміни в паренхімі обох нирок. Пери­пельвікальні кісти лівої нирки. Сольовий діатез. Ознаки хронічного циститу. Гепатоз, компенса­торне розширення холедоху, ознаки хронічного панкреатиту.

Консультація ендокринолога (2025 р.): цукро­вий діабет 2 типу, уперше виявлений, у стадії субкомпенсації. Діабетична нефропатія 3 ст. (швидкість клубочкової фільтрації за формулою СКD-EPI – 50 мл/хв/1,73м²). Діабетична поліней­ропатія. Ожиріння ІІ ст. Ознаки гіперкортицизму. Дисліпідемія.

Консультація професора-терапевта (2025 р.): у хворої визначено хворобу Маделунга ІІ типу (дорсоцервікальна ліпогіпертрофія).

Консультація хірурга (2025 р.): дорсоцерві­кальна ліпогіпертрофія.

МРТ грудної порожнини (21.05.2025 р.): легені розправлені. У плевральних порожнинах випоту немає. Ознак альвеолярної консолідації чи солідних утворень у легенях не виявлено. Ребра правильної форми. Ознак набряку реберно-хре­бетних суглобів не визначається. Грудина без патологічних МР-сигналів. Немає ознак медіасти­нальної лімфаденопатії, середостіння не зміщене, структури середостіння без ознак патології. Ознаки мінімального випоту в порожнині пери­карда – до 4-8 мм завтовшки. На всій поверхні спини визначається потовщення підшкірної жирової клітковини до 90 мм, без ознак інкап­сульованих елементів, без ділянок обмеження дифузії, без набряку, без ознак наявності вира­жених перетинок (септ).

Висновок: ознаки протяжного дифузного по­товщення підшкірної жирової клітковини спини, типу прояв ліпоматозу, без вираженої капсули та без солідного компонента (рис. 4, 5).

Відповідно до клінічних проявів, результатів МРТ та результатів консультації фахівців (тера­певта, хірурга), діагноз ХМ був установлений остаточно. Зважаючи на обсяг ліпоматозного утворення, наявність супутніх захворювань, проведення оперативного втручання з видалення утворення, або проведення ліпосакції, пацієнтці не показано. Хворій рекомендовані дієта з виклю­ченням вуглеводів, що легко засвоюються, утри­мання від прийому їжі після 18 годин і повна від­мова від алкоголю, фізична гімнастика за можливості.

РЕЗУЛЬТАТИ ТА ЇХ ОБГОВОРЕННЯ

ХМ вважається доброякісним захворюванням, а аномальне відкладення жиру зазвичай не призводить до подальшої малігнізації. Однак на сьогоднішній день є дані, що в пацієнтів може бути малігнізація, де найбільш поширеними є рак травного тракту, рак легень та рак щито­подібної залози [46, 47, 48], що відрізняється від епідеміологічних даних, які показали, що тривале інтенсивне куріння та зловживання алкоголем, а також негативні харчові звички є загальними факторами ризику розвитку ХМ та злоякісних новоутворень, а їх синергетичний ефект може бути механізмом збільшення захворюваності на злоякісні пухлини в пацієнтів з ХМ [1, 28]. Оскільки це рідкісне захворювання, поки не існує загальноприйнятих систематичних діагностичних критеріїв, що ускладнює клінічну діагностику ХМ і певною мірою збільшує частоту помилкової діагностики та пропущених діагнозів. Діагноз ХМ переважно ґрунтується на фізичному огляді та клінічних ознаках, доповнених візуальними до­слідженнями, та зіставляється з патологічним діагнозом. Більшість пацієнтів з ХМ мають анамнез алкоголізму, а зовнішній вигляд характе­ризується симетричним розподілом жирової тканини. Наявність типових «хом’ячих щік», «кінських нашийників» та «буйволячих горбів» допомагає в діагностиці. Дані УЗД, КТ та МРТ показують симетрично розподілені неінкапсульо­вані жирові відкладення в підшкірній клітковині чи просторах між м’язами. Післяопераційна гісто­логія не виявляє інкапсульованої ліпоми. При диференціальній діагностиці необхідно виклю­чити інші захворювання з надлишком жирової тканини, такі як морбідне ожиріння, інкапсульо­вана ліпома, ліпосаркома, синдром Кушинга, захворювання слинних залоз, зоб, рак щито­подібної залози та кісти шиї. Пацієнти часто приходять до лікарні для оцінювання безболісних мас у таких ділянках, як шия, груди чи спина. Більшість пацієнтів з ХM не мають очевидних симптомів, а в деяких пацієнтів спостерігаються більші маси, які здавлюють верхнє середостіння, що призводить до серйозних симптомів, таких як астма, хропіння, симптоми обструктивного апное сну й задишка. В описаному випадку обґрунту­вання діагнозу спиралося на клінічні прояви та дані МРТ, що збігається з думкою авторів [14, 36] та відрізняється від інших, які вважають гістологічне дослідження важливим у первинній діагностиці захворювання [25].

На цей час немає специфічного препарату для лікування ХM. Повідомлялося, що пероральні β2-агоністи (такі як сальбутамол) та лікування фібра­тами запобігають відкладенню жиру та сприяють ліполізу, але їх ефективність не під­тверджена [43, 50]. Хірургічне втручання, як і раніше, є найбільш обґрунтованим методом лікування ХM. Звичайні хірургічні процедури включають ліпотомію та ліпосакцію. Необхідні нові методи лікування, щоб поєднати переваги двох методів для досягнення кращих терапев­тичних ефектів.

Особливостями представленого випадку є те, що більшість пацієнтів звертаються за медичною допомогою з естетичних причин через прогре­суючі косметичні деформації, в описаному випадку пацієнтка звернулася до лікаря через обмеження рухів шиї, спричинені великими поти­лично-шийними жировими масами, прогресу­вання задишки, біль у шийному та грудному відділі хребта, слабкість м’язів рук. Діагноз був установлений пацієнтці у віці 73 років, досить запізно, тоді як при ХМ цей стан частіше діагно­стується в людей середнього віку [1]. Більшість авторів, зокрема Liu Q. et al., Mevio E. et al. [9, 10], описують ХМ як таку, що виникає переважно в чоловіків, хронічних споживачів алкоголю, але ми стикнулися з випадком хвороби в жінки, яка прак­тично не вживала алкоголь, що не збігається з біль­шістю описаних у науковій літературі випадків [1].

ВИСНОВКИ

1. Хвороба Маделунга є рідкісним захворю­ванням жирової тканини з досі невідомою етіоло­гією та патогенезом.
2. Діагноз хвороби Маделунга повинен ґрунту­ватися на фізичному огляді та клінічних ознаках, доповнених даними комп’ютерної томографії, магнітно-резонансної томографії або доплеро­графії відповідних ділянок, та зіставлятися з па­томорфологічним діагнозом у складних випадках.
3. Встановлення діагнозу вимагає диферен­ціальної діагностики з іншими захворюваннями, які супроводжуються надлишком жирової тка­нини (морбідне ожиріння, інкапсульована ліпома, ліпосаркома, синдром Кушинга, захворювання слинних залоз, зоб, рак щитоподібної залози та кісти шиї й ін.).
4. Особливої уваги вимагає настороженість щодо можливої малігнізації ліпоми.
5. Хірургічні втручання – ліпотомія та ліпо­сакція, є найбільш обґрунтованими методами лікування хвороби Маделунга. Вибір хірургіч­ного методу повинен ґрунтуватися на об’ємі та місцезнаходження жирових відкладень, перено­симості пацієнтами операції та психологічних очікуваннях пацієнтів. Рекомендується багато­етапний хірургічний підхід, як для зменшення післяопераційних ускладнень, так і для забезпе­чення кращої реабілітації.
6. Специфічних терапевтичних препаратів для лікування хвороби Маделунга не існує.
7. Лікарям загальної практики, до яких зазвичай звертаються пацієнти, рекомендуємо проводити комплексне обстеження, оцінювання їх супутніх захворювань для розробки інди­відуальних та комплексних планів лікування.

Внески авторів:

Родіонова В.В. – курація даних, написання і підготовка тексту публікації, рецензування та редагування;

Яцуба О.О. – ресурси;

Дмитриченко В.В. – перегляд і редагування, візуалізація;

Коваленко О.Ю. – адміністрування.

Фінансування. Дослідження не має зовнішніх джерел фінансування.

Конфлікт інтересів. Автори заявляють про відсутність конфлікту інтересів.

REFERENCES

1. Cucu AI, SavaA, BobuAM, Costea CF, Har­tie VL, Patrascanu E, et  A case report of madelung’s disease in Romania. Diagnostics. 2025 Feb 13;15(4):459. doi: https://doi.org/10.3390/diagnostics15040459   
2. MedappilN, Vasu Madelung’s disease: a spot diagnosis. Indian J Plast Surg. 2010 Jul;43(2):227-8. doi: https://doi.org/10.4103/0970-0358.73472
3. Camillo O. Di Cicco. Queen of Punt – history of dermatology. Egyptian Dermatology Online Jour­nal.   [Internet]. 2005 [cited 2025 Dec 12];1(2):7. Available from: http://www.edoj.org.eg/vol001/00102/07/paper.pdf
4. Greene ML, Glueck CJ, Fujimoto WY, Seegmil­ler JE. Benign symmetric lipomatosis (launois-bensaude adenolipomatosis) with gout and hyperlipoproteinemia. AmJ 1970 Feb;48(2):239-46. doi: https://doi.org/10.1016/0002-9343(70)90120-8
5. Wanke J, Yongjing F. A case report of Madelung’s disease in China. Radiol Case Rep. 2022;17:320-5. doi: https://doi.org/10.1016/j.radcr.2021.10.035
6. Busetto L, Sträter D, Enzi G, Coin A, Sergi G, Inelmen EM, et al. Differential clinical expression of multiple symmetric lipomatosis in men and women. Int J Obes Relat Metab Disord. 2003 Nov;27(11):1419-22. doi: https://doi.org/10.1038/sj.ijo.0802427
7. Harsch IA, Michaeli P, Hahn EG, et al. Launois-Bensaude syndrome in a female with type 2 diabetes. Med Sci Monit. 2002;9:5-8. PMID: 12601297
8. Jang JH, Lee A, Han SA, Ryu JK, Song JY. Mul­tiple symmetric lipomatosis (Madelung's disease) presen­ting as bilateral huge gynecomastia. J Breast Cancer. 2014 Dec;17(4):397-400. doi: https://doi.org/10.4048/jbc.2014.17.4.397
9. Liu Q, Lyu H, Xu B, Lee JH. Madelung disease epidemiology and Clinical characteristics: a systemic review. AestheticPlast 2021;5:977-86. doi: https://doi.org/10.1007/s00266-020-02083-5
10. Mevio E, Sbrocca M, Mullace M, Viglione S, Me­vio N. Multiple symmetric lipomatosis: a review of 3 cases. Case Rep Otolaryngol. 2012;2012:910526. doi: https://doi.org/10.1155/2012/910526
11. Lee HW, Kim TH, Cho JW, Ryu BY, Kim HK, Choi CS. Multiple symmetric lipomatosis: Korean expe­rience. Dermatol2003;29:235-40. doi: https://doi.org/10.1046/j.1524-4725.2003.29056.x
12. Кlopstock T, Naumann M, Schalke B, Bischof F, Seibel P, Kottlors M, et al. Multiple symmetric li­pomatosis: abnormalities in complex IV and multiple deletionsin mitochondrial DNA. Neurology. 1994;44:862-6. doi: https://doi.org/10.1212/WNL.44.5.862
13. Enzi G, Busetto L, Sergi G, Coin A, Inelmen EM, Vindigni V, et al. Multiple symmetric lipomatosis: a rare disease and its possible links to brown adipose tissue. Nutr Metab Cardiovasc Dis. 2015;25:347-53. doi: https://doi.org/10.1016/j.numecd.2015.01.010
14. Moonen MPB, Nascimento EBM, van Kroonen­burgh MJPG, Brandjes D, van Marken Lichtenbelt WD. Absence of 18 F-fluorodeoxyglucose uptake using positron emission tomography/computed tomography in made­lung’s disease: a case report. Clin Obes. 2019 Jun;9(3):e12302. doi:  https://doi.org/10.1111/cob.12302
15. Sanna M, Borgo C, Compagnin C, Favaretto F, Vindigni V, Trento M, et al. White adipose tissue expan­sion in multiple symmetric lipomatosis is associated with upregulation of CK2, AKT and ERK1/2. Int J Mol Sci. 2020Oct26;21(21):7933. doi: https://doi.org/10.3390/ijms21217933
16. LindnerA, MarbachF, Tschernitz S, Ortner C, Ber­neburg M, Felthaus O, et  Calcyphosine-like (CAPSL) is regulated in multiple symmetric lipomatosis and is involved in adipogenesis. Sci Rep. 2019 Jun 11;9(1):8444. doi: https://doi.org/10.1038/s41598-019-44382-1
17. FrąkW, GocelO, Sieniawski K, Sieniawska J, Wło­darczyk M, Dziki  Multiple symmetrical lipomatosis: a literature review and case report of a patient with Madelung’s disease. Pol Przegl Chir. 2023 Oct 13;96(0):130-4. doi: https://doi.org/10.5604/01.3001.0053.5997
18. Grigoraş A, Amalinei C, Balan RA, Giuşcă SE, Avă­dănei ER, Lozneanu L, et al. Adipocytes spectrum — from homeostasia to obesity and its associated pathology. Ann2018 Sep;219:102-20. doi: https://doi.org/10.1016/j.aanat.2018.06.004
19. Chen CY, Fang QQ, Wang XF, Zhang MX, Zhao WY, Shi BH, et al. Madelung’s disease: lipecto myor liposuction? Biomed Res Int. 2018 Feb 21;2018:3975974. doi: https://doi.org/10.1155/2018/3975974
20. Sebastian BM, Roychowdhury S, Tang H, Hil­lian AD, Feldstein AE, Stahl GL, et al. Identification of a Cytochrome P4502E1/Bid/C1q-Dependent Axis Media­ting Inflammationin Adipose Tissue after Chronic Ethanol Feedingto Mice. J Biol Chem. 2011 Oct 14;286(41):35989-97. doi: https://doi.org/10.1074/jbc.M111.254201
21. Verna G, Kefalas N, Boriani F, Carlucci S, Choc I, Boc­chiotti MA. Launois-bensaude syndrome: an unusual lo­ca­lization of obesity disease. Obes Surg. 2008;18(10):1313-7. doi: https://doi.org/10.1007/s11695-008-9502-2
22. Trandafir D, Gogălniceanu D, Trandafir V, Popes­cu E, Costan VV, Vicol C. Sindromul launois-bensaude si rolul chirurgiei cervico-faciale [Internet]. J Chir. 2009 [ci­ted 2025 Dec 12];5(4):359-64. Available from: https://jurnaluldechirurgie.ro/jurnal/docs/jurnal409/art%2006_vol%205_2009_nr%204.pdf
23. Kodish ME, Alsever RN, Block MB. Benign Sym­metric lipomatosis: functional sympathetic denervation of adipose tissue and possible hypertrophy of brown fat. Metabolism.1974 Oct;23(10):937-45. doi: https://doi.org/10.1016/0026-0495(74)90043-2
24. Weiss SW, Goldblum JR. Benign lipomatous tumors. in: enzingerand weiss’s soft tissue tumors. Mosby: St. Louis, MO, USA; 2001. p. 571-637.
25. Ramos S, Pinheiro S, Diogo C, Cabral L, Cru­zeiro C. Madelung disease: a not-so-rare disorder. Ann Plast2010;64:122-4. doi: https://doi.org/10.1097/SAP.0b013e31819bd729
26. Milisavljevic D, Zivic M, Radovanovic Z, Stan­kovic P. Severe dyspnea as atypical presenting symptom of Madelung's disease. Hippokratia. 2010;14:133-5. PMID: 20596272. PMCID: PMC2895283
27. Plummer C, Spring PJ, Marotta R, Chin J, Tay­lor G, Sharpe D, et al. Multiple symmetrical lipomatosis – a mitochondrial disorder of brown fat. Mitochondrion. 2013 Jul;13(4):269-76. doi: https://doi.org/10.1016/j.mito.2013.03.003
28. Enzi G, Inelmen EM, Baritussio A, Dorigo P, Pro­sdocimi M, Mazzoleni F. Multiple symmetric lipomatosis: a defectin adrenergic-stimulated lipolysis. J Clin Invest. 1977 Dec;60(6):1221-9. doi: https://doi.org/10.1172/JCI108881
29. Knöbber D, Feidt H, Hornberger W. [Madelung’s lipomatosis of the neck – Expression of an alcohol-induced endocrine disorder?] HNO. 1986 Nov;34(11):474-6. German. PMID: 3804801.
30. Katou F, Shirai N, Motegi K, Satoh R, Satoh S. [Symmetrical lipomatosis of the tongue manifesting as macroglossia. a report of two cases]. J Craniomaxillofac Surg.1993;21(7):298-301. doi: https://doi.org/10.1016/S1010-5182(05)80351-8
31. Milisavljevic D, Zivic M, Radovanovic Z, Stan­kovic P. Severe dyspnea as atypical presenting symptom of Madelung's disease. Hippokratia. 2010;14:133-5. PMID: 20596272. PMCID: PMC2895283.
32. Torres M, Rodrıguez J, Salvatierra B, Gilsanz F. Airway management with the airtraqina patient with launois-bensaude syndrome. Rev Esp Anestesiol Reanim. 2009;56:579-81. doi: https://doi.org/10.1016/S0034-9356(09)70467-0
33. Mégevand C, Savoy J, Boudrama A, Meier D. [Madelung disease and obstructive sleep apnea syndrome: apropos of a case]. Schweiz Med Wochenschr. 2000;116:123S-126S. French. PMID: 10780092.
34. Fedriani JJ. Two different airway-management strategiesin patients with launois-bensaude lipomatosis. rev esp anestesiol. Reanim. 2014;61:353-4. doi: https://doi.org/10.1016/j.redar.2013.07.008
35. Conroy JP. Airway management: a patient with madelung disease. J Am Assoc Nurse 2006;74:281-4. PMID: 16918119.
36. Jaźwiec P, Pawłowska M, Czerwińska K, Porę­ba M, Gać P, Poręba R. Madelung’s disease as an example of a metabolic disease associated with alcohol abuse — diagnostic importance of computed tomography. Int J Environ Res Public Health. 2022;19(9):5168. doi: https://doi.org/10.3390/ijerph19095168  
37. Gozzo C, Galioto F, Palmucci S, Signorelli SS, Basile A. A non–alcohol-related case of madelung’s di­sease: challenging patient with progressive jugular vein distension. Radiol Case Rep. 2021 Mar 19;16(5):1183-7. doi: https://doi.org/10.1016/j.radcr.2021.02.050
38. El Ouahabi H, Doubi S, Lahlou K, Boujraf S, Ajdi F. Launois-bensaude syndrome: a benign symmetric lipomatosis without alcohol association. Ann Afr Med. 2017;16:33-4. doi: https://doi.org/10.4103/1596-3519.202082
39. Szewc M, Sitarz R, Moroz N, Maciejewski R, Wierzbicki R. Madelung’s disease — progressive, exces­sive, and symmetrical deposition of adiposetis sue in the subcutaneous layer: case report and literature review. Diabetes Metab Syndr Obes. 2018 Nov 26;11:819-25. doi: https://doi.org/10.2147/DMSO.S181154
40. Pricop MO, Balica NC, Poenaru M, Goţia SL, Baderca F, Petrescu PH, et al. Lipomas of cervical area — clinical and pathological considerations. Rom J Morphol Embryol Rev. 2018;59:533-42. PMID: 30173259.
41. Salvatore C, Antonio B, Del VecchioW, LanzaA, Tartaro G, Giuseppe  Giant infiltrating lipoma of the face: CT and MR imaging findings. Am J Neuroradiol. 2003;24:283-6. PMID: 12591650. PMCID: PMC7974129.
42. MunkPL, LeeMJ, Janzen DL, Connell DG, Lo­gan PM, Poon PY, et  Lipoma and Liposarcoma: eva­luation  using CT and MR imaging. Am J Roentgenol. 1997;169:589-94. doi: https://doi.org/10.2214/ajr.169.2.9242783
43. TsilivigkosC, MastronikolisS, Lygeros S, Tsilim­poti D, Papadas  Multiple symmetric lipomatosis (made­lung’s disease)  with symptoms and signs of hypertension, lipodystrophy, and dyspnea: a case report and literature review. Clin Case Rep. 2021 Jun 24;9(6):e04288. doi: https://doi.org/10.1002/ccr3.4288
44. ArdeleanuV, ChicosS, Georgescu C, Tutunaru  Multiple benign symmetric lipomatosis — a differential diagnosis of obesity. Chirurgia (Bucur). 2013 Jul-Aug;108(4):580-3. PMID: 23958107.
45. ZeitlerH, Ulrich-MerzenichG, Richter DF, Vet­ter H, Walger  Multiple benign symmetric lipomatosis – a differential diagnosis of obesity. Is Therea Rationale for Fibrate Treatment? Obes Surg. 2008 Oct;18(10):1354-6. doi: https://doi.org/10.1007/s11695-008-9491-1
46. TizianC, BergerA, Vykoupil  Malignant de­generation in madelung’s disease (benign lipomatosis of the neck): case report. Br J Plast Surg. 1983 Apr;36(2):187-9. doi: https://doi.org/10.1016/0007-1226(83)90089-9
47. BorrielloM, LucidiA, Carbone A, Iannone V, Ferrandina  Malignant transformation of madelung’s disease in a patient with a coincidental diagnosis of breast cancer: a case report. Diagn Pathol. 2012 Sep 1;7:116. doi: https://doi.org/10.1186/1746-1596-7-116
48. RuzickaT, VielufD, Landthaler M, Braun-Fal­co  Benign symmetric lipomatosis launois-bensaude. Report of Ten cases and review of the literature. J Am Acad Dermatol. 1987 Oct;17(4):663-74. doi: https://doi.org/10.1016/s0190-9622(87)70253-9
49. SalinasLMC, Sanchez-Dela Torre Madelung’s disease with polyneuropathy in a non-alcoholic mexican-american male. Med Case Rep Rev. 2018;2:1-3. doi: https://doi.org/10.15761/MCRR.1000121
50. ZeitlerH, Ulrich-MerzenichG, Richter DF, Vet­ter H, Walger  Multiple benign symmetric lipomatosis--a differential diagnosis of obesity: is there a rationale for fibrate treatment? Obes Surg. 2008;18(2):240-2. doi: https://doi.org/10.1007/s11695-008-9491-1
51. TrempM, WettsteinR, Tchang L, Schaefer D, Rieger U, Kalbermatten  Power-assisted liposuction (PAL) in multiple symmetric lipomatosis (MSL) – a longitudinal study. Surg Obes Relat Dis. 2015;11(1):155-60. doi: https://doi.org/10.1016/j.soard.2014.05.004
52. LiR, WangC, Bu Q, Pu W, Zhou B, Che L, et  madelung's disease: analysis of clinical characteristics, fatty mass distribution, comorbidities and treatment of 54 patients in china. Diabetes Metab Syndr Obes. 2022 Aug 6;15:2365-75. doi: https://doi.org/10.2147/DMSO.S363836
53. PintoCI, CarvalhoPJ, Correia  Madelung’s disease: revision of 59 surgical cases. Aesthetic Plast Surg. 2017 Apr;41(2):359-68. doi: https://doi.org/10.1007/s00266-016-0759-x
54. González-GarcíaR, Rodríguez-CampoFJ, Sastre-Pérez J, Muñoz-Guerra  Benign symmetric lipo­matosis (madelung’s disease): case reports and current management. Aesthetic Plast Surg. 2004;28(2):108-12; doi: https://doi.org/10.1007/s00266-004-3123-5
55. UjpálM, NémethZS, Reichwein A, Szabó  Long-term results following surgical treatment of benign symmetric lipomatosis (BSL). Int J Oral Maxillofac Surg. 2001 Dec;30(6):479-83. doi: https://doi.org/10.1054/ijom.2001.0162
56. Brea-GarcíaB, Cameselle-TeijeiroJ, Couto-Gon­zález I, Taboada-Suárez A, González-Álvarez  Made­lung’s disease: comorbidities, fatty mass distribution, and response to treatment of 22 patients. Aesthetic Plast Surg. 2013 Apr;37(2):409-16. doi: https://doi.org/10.1007/s00266-012-9874-5
57. MihetiuA, SanduA, Fluture F, Dută  Madelung disease — between lipectomy and liposuction. Report of a Case and Literature Review. Acta Medica Transilv. 2021;26:36-40. doi: https://doi.org/10.2478/amtsb-2021-0031
58. Zielińska-KaźmierskaB, LewickiM, Manows­ka  Madelung disease. adv dermatol allergol. 2015;32(5):400-3. doi: https://doi.org/10.5114/pdia.2015.54750
59. Rohrich Mesotherapy: What is it? Does it work? Plast Reconstr Surg. 2005;115:1425. doi:https://doi.org/10.1097/01.PRS.0000162243.34988.90
60. RotundaAM, Kolodney Mesotherapy and phosphatidylcholine injections: historical clarification and review. Dermatol Surg. 2006;32:465-80. doi: https://doi.org/10.1111/j.1524-4725.2006.32100.x

Деталі

Перегляди: 202

Ключові слова: мультимодальна анальгезія, хірургічне лікування hallux valgus, парацетамол, диклофенак

Key words: multimodal analgesia, hallux valgus surgery, paracetamol, diclofenac

Реферат

Коригуючі операції з приводу hallux valgus асоціюються з розвитком помірного/сильного післяопераційного болю. Сучасним методом післяопераційного знеболювання є мультимодальна анальгезія із застосуванням блокади нервів на рівні гомілковостопного суглоба, парацетамолу, нестероїдних протизапальних препаратів або селективних інгібіторів ЦОГ-2, дексаметазону та наркотичних анальгетиків в якості «рятувальної анальгезії». Нез’ясованим залишається вплив мультимодальної анальгезії з передопераційним або інтраопераційним початком застосування парацетамолу та диклофенаку на післяопераційне знеболювання при коригуючих операціях з приводу hallux valgus. Проведено порівняльне оціню­вання впливу методів передопераційної та інтраопераційної мультимодальної анальгезії на перебіг раннього післяопераційного періоду при коригуючих операціях з приводу hallux valgus. Тридцять шість пацієнтів, яким було заплановано проведення коригуючих операцій з приводу hallux valgus, були розподілені на 2 групи. В обох групах застосовувались блок нервів на рівні гомілковостопного суглоба, введення парацетамолу та диклофенаку, дексаметазону, «рятувальна анальгезія» морфіном. У групі I (18 пацієнтів) парацетамол та диклофенак почали застосовувати інтраопераційно. У групі II (18 пацієнтів) парацетамол та диклофенак почали застосовувати передопераційно. Досліджувались показники болю в спокої та під час руху, порушення фізичної активності, сну, настрою пацієнтів унаслідок болю, час першої потреби та сумарна доза морфіну, побічні явища. Інтенсивність болю була слабка в обох групах на всіх етапах спостереження. Не було показань для застосування «рятувальної анальгезії» з морфіном в обох групах на всіх етапах дослідження. Показники болю під час руху були достовірно нижче в групі II через 24 години після операції (24,7 (5,7) порівняно з 18,4 (3,5); p<0,0001 в групі I та групі II відповідно). Показники порушення фізичної активності внаслідок болю були достовірно нижче в групі II через 24 години після операції (26,1 (5,2) порівняно з 16,5 (3,1); p<0,0001 в групі I та групі II відповідно). Показники порушення сну внаслідок болю були достовірно нижче в групі II через 18 годин після операції (25,7 (3,3) порівняно з 18,5 (5,1); p<0,0001 в групі I та групі II відповідно). Передопераційний метод мультимодальної анальгезії із введенням парацетамолу та диклофенаку має переваги у впливі на перебіг раннього післяопераційного періоду порівняно з інтраопераційним введенням.

Abstract

Comparative analysis of methods of multimodal analgesia for Hallus Valgus repair surgery. Tutunnyk A.G., Mynka N.V., Kobelyatskyy Yu.Yu. Hallux valgus repair surgery is associated with the development of moderate to severe postoperative pain. Multimodal analgesia is the modern method in postoperative pain management using ankle joint block anesthesia, paracetamol and nonsteroidal anti-inflammatory drugs or cyclooxygenase-2 selective inhibitors; dexamethasone; and opioids as “rescue analgesia”. Insufficient evidence was found for the use of preoperative or intraoperative paracetamol and diclofenac for postoperative pain management after Hallux Valgus correction surgery. The aim of the study was to compare the analgesic effects between preoperative and intraoperative multimodal analgesia in early postoperative period after hallux valgus repair surgery. Thirty six patients scheduled for valgus repair surgery were randomly allocated into two groups. In both groups patients received ankle joint block anesthesia, paracetamol, diclofenac, dexamethasone and morphine as “rescue analgesia”. In group I (18 patients), paracetamol and diclofenac were used intraoperatively. In group II (18 patients), paracetamol and diclofenac were used preoperatively. Rest and moving pain scale; disturbed physical activity, sleep and mood; time of first demand and total morphine dose; adverse events were studied. Pain intensity was low at all observation stages. There were no indications for “rescue analgesia” with morphine in both groups at all observation stages. Group II patients expressed lower moving pain scores 24 hours after operation (24.7 (5.7) vs 18.4 (3.5); p<0.0001 in group I and group II, respectively). Group II patients expressed lower pain disturbed activities scores 24 hours after operation (26.1 (5.2) vs 16.5 (3.1); p<0.0001 in group I and group II, respectively). Group II patients expressed lower pain disturbed sleep scores 18 hours after operation (25.7 (3.3) vs 18.5 (5.1); p<0.0001 in group I and group II, respectively). Preoperative multimodal analgesia with paracetamol and diclofenac has advantages in impact on early postoperative period compared to intraoperative analgesia.

Захворювання на hallus valgus є поширеною хворобою стопи в дорослих, особливо в жінок, досягаючи 33% від загального числа населення. Коригуючі оперативні втручання з приводу цієї хвороби показані пацієнтам, які страждають на сильний біль та деформацію стопи. Кількість таких операцій дуже значна та досягає тільки в США 200000 на рік. Операції з приводу цієї хво­роби мають досить травматичний характер та супро­воджуються розвитком помірного/сильного болю в післяопераційному періоді, що негативно впли­ває на реабілітацію та якість життя пацієнтів [8].

Мультимодальна анальгезія є новітнім трен­дом для післяопераційного знеболювання при коригуючих операціях з приводу hallux valgus [9]. Основні компоненти мультимодальної анальгезії включають блоки нервів на рівні гомілко­востопного суглоба, інфільтрацію рани місцевими анестетиками, системне введення парацетамолу, нестероїдних протизапальних препаратів або селективних інгібіторів циклооксигенази-2 (ЦОГ-2) та дексаметазону. Мультимодальна анальгезія дозволяє знизити потребу в наркотичних аналь­гетиках як препаратах вибору для лікування сильного післяопераційного болю [3, 8]. За даними багатьох авторів [1, 5, 6, 7], превентивне введення місцевого анестетика при блоках нервів знижує збудження та провідність нейрона шля­хом підвищення порогу деполяризації. Також передопераційне введення місцевих анестетиків при блоках нервів запобігає розвиткові централь­ної гіперсенсетизації нейронів та хронічного болю [6]. Так, блоки нервів на рівні гомілково­стопного суглоба із застосуванням 0,25% бупі­вакаїну забезпечили щонайменше 6-годинну анальгезію під час спокою та руху та зменшили потребу в наркотичних анальгетиках [3]. Засто­сування парацетамолу та нестероїдних проти­запальних препаратів, окрім протизапальної дії, також запобігає розвиткові центральної гіпер­сенсетизації нейронів та хронічного болю [9]. Системне введення парацетамолу, нестероїдних протизапальних препаратів або селективних інгібіторів ЦОГ-2 слід починати вводити в передопераційному або інтраопераційному пе­ріоді та продовжувати введення після операції. Хоча механізм анальгетичної дії стероїдів не до кінця зрозумілий, але їх системне або пери­невральне введення разом з місцевими анесте­тиками значно збільшує час дії блокади нервів [2]. Наркотичні анальгетики рекомендується засто­совувати в якості «рятувальної анальгезії».

Нез’ясованим залишається вплив методів мультимодальної анальгезії з передопераційним або інтраопераційним початком застосування парацетамолу та диклофенаку на післяопераційне знеболювання при коригуючих операціях з приводу hallux valgus.

Метою дослідження була порівняльна оцінка впливу методів передопераційної та інтра­опера­ційної мультимодальної анальгезії на післяопера­ційне знеболювання при коригуючих операціях з приводу hallux valgus.

МАТЕРІАЛИ ТА МЕТОДИ ДОСЛІДЖЕНЬ

Дослідження проводилося згідно з основними правилами, викладеними у Гельсінській декла­рації ВМА «Етичні принципи медичних до­сліджень за участю людини у якості об’єкта дослідження» та «Загальній декларації про біое­тику та права людини» (ЮНЕСКО), принципів Належної клінічної практики (ICH E6(R3) Good Clinical Practice, 2025) та наказу МОЗ України № 690 від 29.01.2025. Пацієнти були повністю по­інформовані про цілі, організацію та методи дослідження та надали інформовану згоду на участь у дослідженні. Було вжито всіх заходів для забезпечення анонімності пацієнтів. Матеріал цього дослідження розглянуто на засіданні комісії з біоетики ДДМУ та затверджено протоколом № 34 від 14.01.2026 р.

Статистичний аналіз проводився за допо­могою Microsoft Excel (Office Home Business 2KB4Y-6H9DB–BM47K-749PV-PG3KT) та про­грамного продукту STATISTICA v.6/1 (Statsoft Inc., США, № ліцензії AGAR909E415822FA).

Статистичний аналіз включав параметричну, описову й аналітичну статистику. Методи засто­совувались залежно від кількості порівнюваних груп та від наявності/відсутності нормального розподілення кількісних ознак.

Перевірку відповідності розподілу кількісних ознак нормальному закону проводили за критерієм Шапіро-Вілка. Центральні тенденції опи­сувалися за допомогою середньої арифметич­ної (М – mean), стандартного відхилення (SD – Standard deviation), довірчого інтервалу (95% ДІ) при нормальному розподілі кількісних ознак. Для порівняння показників у групах дослідження використову­вався параметричний аналіз (ANOVA). Показники болю за візуальною аналоговою шкалою (ВАШ) оцінювали за допомогою t-критерію Стьюдента. Значення p<0,05 були оцінені як значущі.

У клінічну групу увійшло 36 пацієнтів (жінки) I – II класу з ASA, яким була проведена операція – коригуюча остеотомія I-х плеснових кісток з приводу hallux valgus, корекція м’яких тканин з приводу помірної та тяжкої вальгусної дефор­мації великого пальця стопи (hallux valgus).

У дослідження не включались пацієнти з периферичною нейропатією, цукровим діабетом, некорегованою гіпертензією, алергією до міс­цевих анестетиків та нестероїдних протизапаль­них препаратів, порушенням коагуляції, пору­шеннями функції печінки та нирок, відмовою підписати інформовану згоду на проведення анестезії. Для аналізу методом випадкової ви­бірки були сформовані дві групи пацієнтів. За 40 хвилин до операції всім хворим внутрішньо­венно вводили 5 мг мідазоламу в якості преме­дикації. У групі I (18 пацієнтів) парацетамол та диклофенак почали застосовувати інтраопера­ційно. Через 30 хвилин після початку операції внутрішньовенно вводили 75 мг диклофенаку та 1 г парацетамолу. У групі II (18 пацієнтів) параце­тамол та диклофенак засто­совувати «ви­переджуючи» перед операцією. За 30 хвилин до початку операції внутрішньовенно вводили 75 мг диклофенаку та 1 г парацетамолу. В обох групах проводили блоки великогомілкового нерва (n.tibialis), глибокого (n.deep peroneal) та поверх­невого малогомілкового нерва (n.superficial pero­neal) на рівні великогомілкового суглоба. Блокаду великогомілкового нерва проводили із застосу­ванням нейростимулятора “Stimuplex HNS 11” та голки “Contiplex” D фірми B. Braun. Вводили 8 мл 0,5% розчину бупівакаїну. Блокаду глибокого малогомілкового нерва проводили класичним методом із застосуванням голки 25G довжиною 4 см. Вводили 2 мл 0,5% розчину бупівакаїну. Блокаду поверхневого малогоміл­кового нерва проводили класичним методом із застосуванням голки 25G довжиною 4 см. Вводили 2 мл 0,5% розчину бупівакаїну.

Далі проводилась монолатеральна спінальна анестезія із застосуванням 7,5 мг гіпербаричного бупівакаїну в позиції на боці. Через 15 хвилин пацієнтів повертали на спину та, після оціню­вання сенсорного/моторного блоку, накладали джгут на гомілку. Під час операції внутріш­ньовенно вводили 12 мг дексаметазону. Після операції продовжували внутрішньовенне введен­ня 1 г парацетамолу кожні 6 годин протягом 36 годин після операції та диклофенаку 75 мг одноразово через 24 години після першої дози. «Рятувальна анальгезія» передбачала введення 10 мг морфіну внутрішньом’язово за потребою пацієнта та при виникненні болю ≥31 мм за ВАШ під час руху, через 0, 6, 12, 18, 24, 30, 36 годин після операції.

Групи між собою були порівняні за такими параметрами: вік пацієнтів, вага та середня тривалість операції. Ці параметри були перевірені на нормальність розподілення. Отримано нор­мальне розподілення, що дозволяє порівнювати групи за параметричними методами (t-критерій Стьюдента (табл. 1)). Виявлено, що групи між собою за показниками віку, ваги та тривалості операції не мають статистичної різниці (p˃0,05), що дозволяє об’єктивно їх порівнювати між собою.

Досліджувались показники болю в спокої та під час руху, порушення фізичної активності, сну, настрою пацієнтів унаслідок болю, час першої потреби та сумарна доза морфіну в якості «ряту­вальної анальгезії» та побічні явища. Дослід­жували біль у спокої та під час руху при згинанні/розгинанні стопи та пальців. Для цього застосовували візуальну аналогову шкалу (ВАШ) оцінки болю з градацією від 0 мм до 100 мм з підрахунком на кожному етапі дослідження. Інтенсивність болю від 0 до 30 мм вважали як «слабку»; від 31 мм до 50 мм як «помірну»; вище 51 мм як «сильну». Також застосовували ВАШ оцінки порушення фізичної активності, сну та змін настрою внаслідок болю з градацією від 0 мм до 100 мм з підрахунком на кожному етапі до­слідження [4]. Порушення внаслідок болю від 0 до 30 мм вважали як «слабкі»; від 31 мм до 50 мм як «помірні»; вище 51 мм як «сильні». Вира­женість таких побічних явищ, як шкірний свербіж, нудота та блювання, оцінювались за градаціями – немає, легкий ступінь, помірний ступінь, тяжкий ступінь. Етапи дослідження включали 6, 12, 18, 24, 30 та 36 годин після операції.

РЕЗУЛЬТАТИ ТА ЇХ ОБГОВОРЕННЯ

Було обстежено 36 пацієнток, розподілених на 2 групи. Пацієнти обох груп не мали статистично достовірної різниці за віком та вагою та тривалістю операції.

Показники болю в спокої не відрізнялись між групами на всіх етапах спостереження (табл. 2). Інтенсивність болю була слабка на всіх етапах спостереження.

Показники болю під час руху були достовірно нижче в групі II через 24 години після операції (24,7 (5,7) порівняно з 18,4 (3,5); p<0,0001 в групі I та групі II відповідно). Інтенсивність болю була слабка на всіх етапах спостереження (табл. 3). Не було показань для застосування «рятувальної анальгезії» в обох групах на всіх етапах дослідження.

Показники порушення фізичної активності внаслідок болю були достовірно нижче в групі II через 24 години після операції (26,1 (5,2) порів­няно з 16,5 (3,1); p<0,0001 в групі I та групі II відповідно). Порушення фізичної активності внаслідок болю було слабким на всіх етапах спостереження (табл. 4).

Показники порушення сну внаслідок болю були достовірно нижче в групі II через 18 годин після операції (25,7 (3,3) порівняно з 18,5 (5,1); p<0,0001 в групі I та групі II відповідно). Пору­шення сну внаслідок болю було слабким на всіх етапах спостереження (табл. 5).

Показники порушення настрою внаслідок болю не відрізнялись між групами на всіх етапах спостереження (табл. 6). Порушення сну вна­слі­док болю було слабким на всіх етапах спостереження.

Побічні явища у вигляді нудоти помірного ступеня виникали у 2 пацієнтів в групі I та 2 пацієнтів в групі II через 12 годин після операції. Після введення 4 мг ондансетрону внутріш­ньо­венно явища нудоти були успішно усунені.

Схожі результати застосування парацетамолу та кетопрофену отримані в дослідженні Ravanbod [6], але потребували застосування морфіну в якості «рятувальної анальгезії» на першу та другу добу після операції. Застосувались внутріш­ньо­венно кетопрофен 100 мг та парацетамол 1000 мг тричі на добу, що призводило до розвитку нудоти/блювання в чотирьох випадках. В якості «рятувальної анальгезії» було застосовано морфіну сульфат 7,5 мг. У нашому дослідженні вдалось відмовитись від застосування морфіну за рахунок запобігання виникнення помір­ного/силь­ного післяопераційного болю.

У рекомендаціях PROSPECT [3, 9] не на­дається перевага початку введення параце­тамолу, нестероїдних протизапальних препаратів або селективних інгібіторів ЦОГ-2, у комплексі мультимодальної анальгезії, до операції або під час операції. Також значно відрізняються дози та режим введення цих препаратів [3, 6, 8].

Таким чином, передопераційний початок застосування парацетамолу та диклофенаку по­кращує післяопераційне знеболювання за рахунок зниження болю під час руху, порушення фізичної активності внаслідок болю через 24 години після операції та порушення сну внаслідок болю через 18 годин після операції. На нашу думку, це зумовлено впливом парацетамолу та диклофенаку на запобігання розвитку болю до початку опе­рації, порівняно з інтраопераційним введенням цих препаратів. Слід підкреслити, що обидва варіанти мультимодальної анальгезії дозволяли запобігти розвитку помірного/сильного болю протягом 36 годин після операції. Слабкий біль у спокої та під час руху супроводжувався слабким порушення фізичної активності, сну та настрою. Пацієнти в обох групах не потребували застосу­вання морфіну в якості «рятувальної анальгезії».

ВИСНОВКИ

1. Обидва методи мультимодальної анальгезії дозволяли запобігти розвитку помірного/силь­ного болю та відмовитися від застосування морфіну в якості «рятувальної анальгезії» про­тягом 36 годин після коригуючих операцій з приводу hallux valgus.
2. Метод передопераційної мультимодальної анальгезії краще знижує біль під час руху через 24години після операції та знижує порушення фізичної активності внаслідок болю.
3. Передопераційне застосування комбінації парацетамолу та диклофенаку ефективніше змен­шує частоту виникнення порушення сну внаслі­док болю через 18годин після операції, ніж метод інтраопераційної мультимодальної анальгезії.
4. Передопераційний метод мультимодальної анальгезії має переваги у впливі на перебіг раннього післяопераційного періоду.

Внески авторів:

Тютюнник А.Г. – концептуалізація, дослід­ження, формальний аналіз;

Минка Н.В. – формальний аналіз, досліджен­ня, методологія, написання – початковий проєкт;

Кобеляцький Ю.Ю. –  візуалізація, формаль­ний аналіз, ведення, написання – рецензування та редагування.

Фінансування. Дослідження не має зовнішніх джерел фінансування.

Конфлікт інтересів. Автори заявляють про відсутність конфліктів інтересів.

REFERENCES

1. Desai N, Albrecht E. Local anaesthetic adjuncts for peripheral nerve blockade. Current Opinion in Anesthesiology 2023;36(5):533-40. doi: https://10.1097/ACO.0000000000001272
2. Desai N, Albrecht E. Minimal clinically important difference: bridging the gap between statistical signi­ficance and clinical meaningfulness. J Clin Anesth 2024; 94:111366. doi: https://10.1016/j.jclinane.2023.111366
3. Joshi GP, Albrecht E, Van de Velde M, et al. PROSPECT methodology for developing procedure-specific pain management recommendations: an update. Anaesthesia. 2023;78(11):1386-92. doi: https://10.1111/anae.16135
4. Miao-Pei Su, Pen-Ju Huang, Kuang-Yi Tseng, et al. Pretreatment of ankle nerve block provides better postoperative analgesia than peri-incisional local anesthetic infiltration in hallux valgus correction surgery. Kaohsiung J Med Sci. 2019;35:168-174. doi: https://10.1002./kjm2.12029
5. Pulitano R, Giudice M, La Verde F, et al. Ropi­vacaine and magnesium sulfate in sciatic nerve block at the popliteal level: randomized double-blind study. Minerva Anesthesiol. 2024;90:1090-7. doi: https://10.23736/S0375-9393.24.18126-6
6. Ravanbod HR. Analgesic efficacy of local versus proximal nerve blocks after hallux valgus surgery: a systematic review. Journal of Foot and Ankle Research. 2022;15:78. doi: https://10.1186/s13047-022-00581-0
7. Scwartz G, Gadsden JC, Gonzales J, et al. A phase 3 active-controlled trial of liposomal bupivacaine via scatic nerve block in the popliteal fossa after buneonectomy. J Clin Anesth. 2024;94:111402. doi: https://10.1016/j.clinane.2024.111402
8. Swisser F, Brethe Y, Choquet O, et al. Plantar compartment block improves enhanced recovery after hallux valgus surgery: a randomized, comparative, double-blind study. Anesthesiology. 2024;141:891-903. doi: https://10.1097/ALN.0000000000005180
9. Wust M, Desai N, Joshi Girish P, et al. Pain management after hallux valgus repair surgery: an updated systematic review and procedure-specific postoperative pain management (PROSPECT) recommendations. Eur J Anaesthesiol. 2026;43:11-8. doi: https://10.1097/EJA.0000000000002302